Incidental Mutation 'R7759:Adck1'
ID 597751
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene Name aarF domain containing kinase 1
Synonyms 2610005A10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028105; MGI:1919363

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 88360554-88461724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88402117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 122 (A122T)
Ref Sequence ENSEMBL: ENSMUSP00000098724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
AlphaFold Q9D0L4
Predicted Effect possibly damaging
Transcript: ENSMUST00000101165
AA Change: A122T

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044
AA Change: A122T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166940
AA Change: A122T

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044
AA Change: A122T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222695
AA Change: A122T

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88368422 missense probably benign 0.00
IGL00822:Adck1 APN 12 88455516 missense probably damaging 0.99
IGL01370:Adck1 APN 12 88456733 splice site probably benign
IGL01480:Adck1 APN 12 88456865 nonsense probably null
IGL01994:Adck1 APN 12 88431156 missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88446710 missense probably damaging 0.96
IGL03058:Adck1 APN 12 88459130 missense probably benign
IGL03196:Adck1 APN 12 88431115 missense probably damaging 1.00
IGL03307:Adck1 APN 12 88459053 missense possibly damaging 0.94
full-figured UTSW 12 88441117 missense possibly damaging 0.63
0152:Adck1 UTSW 12 88431151 missense probably benign 0.03
R0107:Adck1 UTSW 12 88446656 missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0179:Adck1 UTSW 12 88459172 missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88371691 splice site probably benign
R0561:Adck1 UTSW 12 88368434 missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88368348 start codon destroyed probably null 1.00
R1005:Adck1 UTSW 12 88402102 missense probably damaging 0.98
R1524:Adck1 UTSW 12 88402084 missense probably damaging 1.00
R2016:Adck1 UTSW 12 88461092 missense probably damaging 1.00
R4438:Adck1 UTSW 12 88431150 nonsense probably null
R4745:Adck1 UTSW 12 88402179 splice site probably null
R4827:Adck1 UTSW 12 88446719 missense probably benign 0.06
R4859:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4885:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4921:Adck1 UTSW 12 88441138 missense probably benign 0.10
R5383:Adck1 UTSW 12 88455603 missense probably benign 0.04
R5958:Adck1 UTSW 12 88459052 missense probably benign 0.33
R6028:Adck1 UTSW 12 88402132 missense probably benign
R6199:Adck1 UTSW 12 88441117 missense possibly damaging 0.63
R6317:Adck1 UTSW 12 88402151 missense probably damaging 1.00
R6616:Adck1 UTSW 12 88461188 missense unknown
R6715:Adck1 UTSW 12 88459080 missense probably damaging 1.00
R6915:Adck1 UTSW 12 88455620 missense probably damaging 1.00
R7295:Adck1 UTSW 12 88431045 missense probably damaging 1.00
R7387:Adck1 UTSW 12 88461052 missense probably benign
R7520:Adck1 UTSW 12 88459205 critical splice donor site probably null
R7562:Adck1 UTSW 12 88368433 missense possibly damaging 0.77
R7745:Adck1 UTSW 12 88456800 missense probably benign
R8092:Adck1 UTSW 12 88461061 missense possibly damaging 0.68
R8336:Adck1 UTSW 12 88368479 missense probably damaging 1.00
R9145:Adck1 UTSW 12 88368423 missense probably benign 0.00
R9443:Adck1 UTSW 12 88371780 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGAACAGACTGCACTCAC -3'
(R):5'- TTAGTTCAGCTAGTGACGGC -3'

Sequencing Primer
(F):5'- AACAGACTGCACTCACTCCTCTTG -3'
(R):5'- CTGAGACATGTGATTCTGCATCAG -3'
Posted On 2019-11-26