Mutagenetix > Incidental Mutation

Incidental Mutation 'R7759:Mtrr'

597754

Institutional Source

Beutler Lab

Gene Symbol

Mtrr

Ensembl Gene

ENSMUSG00000034617

Gene Name

5-methyltetrahydrofolate-homocysteine methyltransferase reductase

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_172480; MGI: 1891037

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68560780-68582149 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68570027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 373 (E373K)

Ref Sequence

ENSEMBL: ENSMUSP00000039810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045827] [ENSMUST00000223101] [ENSMUST00000223398]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000045827
AA Change: E373K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617
AA Change: E373K

Domain	Start	End	E-Value	Type
Pfam:Flavodoxin_5	5	126	2.7e-9	PFAM
Pfam:Flavodoxin_1	6	142	4.3e-32	PFAM
Pfam:FAD_binding_1	267	490	2.6e-51	PFAM
Pfam:NAD_binding_1	540	660	5.4e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000220544

Predicted Effect

probably benign
Transcript: ENSMUST00000223101

Predicted Effect

probably damaging
Transcript: ENSMUST00000223398
AA Change: E373K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Mutations in a similar gene in human have been associated with cblE complementation type homocystinuria-megaloblastic anemia and susceptibility to folate-sensitive neural tube defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are viable and display a male-specific reduction in postnatal weight gain as well as hyperhomocysteinemia, hypomethionemia, increased tissue methyltetrahydrofolate, and AdoMet/AdoHcy ratios that range from high to slightly below normal. [provided by MGI curators]

Allele List at MGI

All alleles(46) : Gene trapped(46)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Mtrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01787:Mtrr	APN	13	68571147	missense	probably damaging	1.00
IGL01806:Mtrr	APN	13	68580600	missense	possibly damaging	0.92
IGL01808:Mtrr	APN	13	68566093	missense	probably benign	0.00
IGL01875:Mtrr	APN	13	68572609	missense	probably damaging	1.00
IGL02137:Mtrr	APN	13	68568801	missense	possibly damaging	0.75
IGL02186:Mtrr	APN	13	68564357	missense	probably benign
IGL03114:Mtrr	APN	13	68564322	nonsense	probably null
3-1:Mtrr	UTSW	13	68575016	critical splice donor site	probably null
H8562:Mtrr	UTSW	13	68564377	missense	probably damaging	0.97
N/A:Mtrr	UTSW	13	68575397	splice site	probably benign
R0007:Mtrr	UTSW	13	68575330	missense	probably benign	0.02
R0741:Mtrr	UTSW	13	68579539	splice site	probably null
R2140:Mtrr	UTSW	13	68568940	missense	possibly damaging	0.47
R2513:Mtrr	UTSW	13	68566973	nonsense	probably null
R4604:Mtrr	UTSW	13	68564512	splice site	probably null
R5501:Mtrr	UTSW	13	68579647	missense	probably damaging	1.00
R5658:Mtrr	UTSW	13	68568915	missense	possibly damaging	0.67
R6477:Mtrr	UTSW	13	68570073	missense	probably damaging	1.00
R6694:Mtrr	UTSW	13	68564333	missense	probably benign
R6979:Mtrr	UTSW	13	68570003	critical splice donor site	probably null
R7094:Mtrr	UTSW	13	68579684	missense	possibly damaging	0.83
R7296:Mtrr	UTSW	13	68568860	nonsense	probably null
R7354:Mtrr	UTSW	13	68566207	missense	probably damaging	1.00
R7378:Mtrr	UTSW	13	68564402	missense	probably damaging	1.00
R7546:Mtrr	UTSW	13	68582149	unclassified	probably benign
R7562:Mtrr	UTSW	13	68566217	missense	probably damaging	0.96
R7975:Mtrr	UTSW	13	68579547	splice site	probably null
R8101:Mtrr	UTSW	13	68577621	missense	probably damaging	1.00
R8168:Mtrr	UTSW	13	68572613	missense	probably benign	0.00
R9097:Mtrr	UTSW	13	68575322	missense	probably benign	0.28
R9260:Mtrr	UTSW	13	68580555	missense	possibly damaging	0.70
R9295:Mtrr	UTSW	13	68571139	missense	possibly damaging	0.94
R9516:Mtrr	UTSW	13	68572636	missense	probably benign	0.00
R9517:Mtrr	UTSW	13	68580611	missense	probably benign	0.06
R9627:Mtrr	UTSW	13	68577637	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCAGCAGTAACCAAGTGGC -3'
(R):5'- AGTCGCAGCTGGAACATTG -3'

Sequencing Primer
(F):5'- CCAAGTGGCACTGCACAGATG -3'
(R):5'- GCTGGAACATTGCCATAAGTC -3'

Posted On

2019-11-26