Mutagenetix > Incidental Mutations

Incidental Mutation 'R7759:Setdb2'

597757

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.524) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 59419364 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 168 (T168K)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

Predicted Effect

probably damaging
Transcript: ENSMUST00000095775
AA Change: T184K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: T184K

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111253

Predicted Effect

probably damaging
Transcript: ENSMUST00000161459
AA Change: T168K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: T168K

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCGACACTGATTCCACTCCATTAC -3'
(R):5'- CCTCCCTGTGAAGAATAAAGCTG -3'

Sequencing Primer
(F):5'- CCACGTCAGAAACAACTTCATTTTG -3'
(R):5'- TGACAATTTAGTGAAAAAGGAAGCCC -3'

Posted On

2019-11-26