Incidental Mutation 'R7759:Setdb2'
ID 597757
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 59656813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 168 (T168K)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: T184K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: T184K

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111253
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: T168K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: T168K

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,682,514 (GRCm39) G215V probably benign Het
Adamts1 C A 16: 85,594,683 (GRCm39) G652C probably damaging Het
Adck1 G A 12: 88,368,887 (GRCm39) A122T possibly damaging Het
Akap1 A C 11: 88,736,659 (GRCm39) M34R probably damaging Het
Apc2 C T 10: 80,147,030 (GRCm39) R695C probably damaging Het
Apon T A 10: 128,090,384 (GRCm39) W21R probably benign Het
Arhgef16 T C 4: 154,371,432 (GRCm39) T254A probably benign Het
Arid5b T A 10: 67,933,632 (GRCm39) S757C probably damaging Het
B020004C17Rik A C 14: 57,254,242 (GRCm39) I122L possibly damaging Het
Bckdhb T G 9: 83,892,379 (GRCm39) V270G probably damaging Het
Cacna1d A G 14: 29,821,145 (GRCm39) Y1146H probably benign Het
Carmil2 A G 8: 106,423,668 (GRCm39) D1214G possibly damaging Het
Ccdc142 T C 6: 83,084,912 (GRCm39) V636A probably benign Het
Chd9 T C 8: 91,704,178 (GRCm39) probably null Het
Csmd3 A G 15: 47,561,569 (GRCm39) S1336P Het
Cubn A G 2: 13,352,961 (GRCm39) Y1926H probably damaging Het
Dock4 A T 12: 40,867,735 (GRCm39) D1437V probably damaging Het
Eme1 A T 11: 94,536,666 (GRCm39) Y504* probably null Het
Enah G A 1: 181,746,009 (GRCm39) A687V unknown Het
Endou A C 15: 97,611,747 (GRCm39) V339G probably damaging Het
Ephb6 G A 6: 41,591,539 (GRCm39) R232H probably benign Het
Ephx2 G A 14: 66,326,968 (GRCm39) A409V possibly damaging Het
Esd T A 14: 74,983,007 (GRCm39) C219* probably null Het
Fscb A T 12: 64,520,866 (GRCm39) M200K probably benign Het
Gabra6 A T 11: 42,208,508 (GRCm39) V108D probably damaging Het
Gm11555 A G 11: 99,540,568 (GRCm39) V137A unknown Het
Gpld1 A G 13: 25,146,383 (GRCm39) D209G probably damaging Het
Ikzf1 T A 11: 11,719,256 (GRCm39) I408N probably damaging Het
Itgb4 A G 11: 115,894,536 (GRCm39) R1364G possibly damaging Het
Kif26b A C 1: 178,506,509 (GRCm39) K195T probably damaging Het
Mfsd12 T C 10: 81,199,427 (GRCm39) W440R probably benign Het
Mtrr C T 13: 68,718,146 (GRCm39) E373K probably damaging Het
Mug2 T A 6: 122,058,317 (GRCm39) V1293E probably damaging Het
Myof C A 19: 37,928,346 (GRCm39) A1068S probably benign Het
Ncam2 A G 16: 81,412,672 (GRCm39) D720G probably damaging Het
Nova2 G T 7: 18,692,176 (GRCm39) G435V Het
Oacyl T A 18: 65,843,631 (GRCm39) D109E probably damaging Het
Or2y1g A T 11: 49,171,463 (GRCm39) M163L probably benign Het
Or56a4 G A 7: 104,806,232 (GRCm39) S219F probably damaging Het
Pdcd11 G A 19: 47,101,637 (GRCm39) V941M possibly damaging Het
Pdzd8 C A 19: 59,288,358 (GRCm39) R1014L probably damaging Het
Ppm1h T G 10: 122,740,018 (GRCm39) D364E probably benign Het
Rigi C A 4: 40,225,104 (GRCm39) A298S probably damaging Het
Rp1 T C 1: 4,415,107 (GRCm39) N2002D probably benign Het
Sall1 C T 8: 89,768,979 (GRCm39) probably null Het
Scn10a C T 9: 119,477,198 (GRCm39) W728* probably null Het
Sgms1 T C 19: 32,137,276 (GRCm39) I97V probably benign Het
Slc8a3 A T 12: 81,361,325 (GRCm39) M498K probably benign Het
Smpd4 A T 16: 17,456,497 (GRCm39) E362D probably damaging Het
Ssc5d A T 7: 4,940,529 (GRCm39) K881* probably null Het
Strn4 A G 7: 16,564,309 (GRCm39) E313G probably damaging Het
Tas2r113 A T 6: 132,870,890 (GRCm39) N306I possibly damaging Het
Tdrd6 G T 17: 43,935,730 (GRCm39) R1773S probably benign Het
Thbs2 T C 17: 14,897,321 (GRCm39) E729G probably damaging Het
Tnfrsf23 G A 7: 143,224,572 (GRCm39) T135I probably damaging Het
Tollip A G 7: 141,438,276 (GRCm39) M218T probably benign Het
Tyk2 A T 9: 21,031,554 (GRCm39) probably null Het
Ubr2 G A 17: 47,296,974 (GRCm39) R269C probably damaging Het
Uggt1 A T 1: 36,185,806 (GRCm39) M1459K possibly damaging Het
Upf1 A G 8: 70,786,730 (GRCm39) V929A probably benign Het
Usp48 T C 4: 137,321,763 (GRCm39) S24P probably benign Het
Vmn1r214 G A 13: 23,218,631 (GRCm39) E42K not run Het
Vmn1r83 G T 7: 12,055,360 (GRCm39) D232E probably benign Het
Vmn2r25 C T 6: 123,800,339 (GRCm39) V668I probably damaging Het
Vmn2r6 A G 3: 64,463,991 (GRCm39) I281T probably damaging Het
Ywhag A T 5: 135,940,043 (GRCm39) Y184N probably damaging Het
Zdbf2 A C 1: 63,347,535 (GRCm39) E1971D possibly damaging Het
Zfp568 G A 7: 29,722,839 (GRCm39) A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 (GRCm39) D248G probably benign Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGACACTGATTCCACTCCATTAC -3'
(R):5'- CCTCCCTGTGAAGAATAAAGCTG -3'

Sequencing Primer
(F):5'- CCACGTCAGAAACAACTTCATTTTG -3'
(R):5'- TGACAATTTAGTGAAAAAGGAAGCCC -3'
Posted On 2019-11-26