Incidental Mutation 'R7759:Ncam2'
ID 597764
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Name neural cell adhesion molecule 2
Synonyms Ocam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 81200697-81626828 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81615784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 720 (D720G)
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067602]
AlphaFold O35136
Predicted Effect probably damaging
Transcript: ENSMUST00000067602
AA Change: D720G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: D720G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
BB009:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
BB019:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0097:Ncam2 UTSW 16 81517537 missense probably damaging 1.00
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1646:Ncam2 UTSW 16 81465706 critical splice donor site probably benign
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2157:Ncam2 UTSW 16 81490389 missense probably damaging 1.00
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5526:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6050:Ncam2 UTSW 16 81443166 nonsense probably null
R6212:Ncam2 UTSW 16 81432762 missense probably damaging 1.00
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
R7568:Ncam2 UTSW 16 81589801 missense probably benign 0.19
R7686:Ncam2 UTSW 16 81621454 missense probably damaging 0.99
R7848:Ncam2 UTSW 16 81490379 missense probably benign
R7932:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R8078:Ncam2 UTSW 16 81443248 missense possibly damaging 0.60
R8287:Ncam2 UTSW 16 81526995 missense probably benign 0.07
R8354:Ncam2 UTSW 16 81512959 missense probably benign 0.00
R8429:Ncam2 UTSW 16 81589635 missense probably damaging 1.00
R8507:Ncam2 UTSW 16 81512979 missense possibly damaging 0.63
R8546:Ncam2 UTSW 16 81517531 missense probably benign 0.21
R8775:Ncam2 UTSW 16 81517541 missense probably benign 0.18
R8775-TAIL:Ncam2 UTSW 16 81517541 missense probably benign 0.18
R9082:Ncam2 UTSW 16 81615772 missense probably damaging 1.00
R9346:Ncam2 UTSW 16 81455316 missense probably benign 0.07
R9386:Ncam2 UTSW 16 81455364 missense probably damaging 1.00
R9498:Ncam2 UTSW 16 81512999 missense probably benign 0.03
R9510:Ncam2 UTSW 16 81623453 makesense probably null
R9587:Ncam2 UTSW 16 81465613 missense probably benign 0.00
R9616:Ncam2 UTSW 16 81443254 missense probably damaging 1.00
R9642:Ncam2 UTSW 16 81621363 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGATTAAGTTGCCACTCACTAC -3'
(R):5'- AAGTTGTACTTGTGCTCCACTC -3'

Sequencing Primer
(F):5'- GTTGCCACTCACTACTCCATATTTTC -3'
(R):5'- CCACTCATGGGAGGTGGTG -3'
Posted On 2019-11-26