Mutagenetix > Incidental Mutation

Incidental Mutation 'R7759:Adamts1'

597765

Institutional Source

Beutler Lab

Gene Symbol

Adamts1

Ensembl Gene

ENSMUSG00000022893

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1

Synonyms

METH1, ADAMTS-1, ADAM-TS1, METH-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85793827-85803113 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 85797795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 652 (G652C)

Ref Sequence

ENSEMBL: ENSMUSP00000023610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023610] [ENSMUST00000125897]

AlphaFold

P97857

Predicted Effect

probably damaging
Transcript: ENSMUST00000023610
AA Change: G652C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023610
Gene: ENSMUSG00000022893
AA Change: G652C

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	22	194	1.3e-27	PFAM
Pfam:Reprolysin_4	257	464	2.2e-9	PFAM
Pfam:Reprolysin_5	257	466	1.6e-14	PFAM
Pfam:Reprolysin	259	468	3.6e-22	PFAM
Pfam:Reprolysin_2	279	458	2.1e-10	PFAM
Pfam:Reprolysin_3	281	413	4.8e-14	PFAM
ACR	469	549	7.36e-8	SMART
TSP1	563	615	3.77e-14	SMART
Pfam:ADAM_spacer1	726	844	1.7e-35	PFAM
TSP1	858	911	1.22e-8	SMART
TSP1	912	968	1.2e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125897
AA Change: G389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118471
Gene: ENSMUSG00000022893
AA Change: G389C

Domain	Start	End	E-Value	Type
Pfam:Reprolysin_4	1	201	2.3e-9	PFAM
Pfam:Reprolysin_5	1	203	8.8e-14	PFAM
Pfam:Reprolysin	1	205	5e-22	PFAM
Pfam:Reprolysin_2	16	195	8.6e-10	PFAM
Pfam:Reprolysin_3	19	150	4.2e-14	PFAM
ACR	206	286	7.36e-8	SMART
TSP1	300	352	3.77e-14	SMART
Pfam:ADAM_spacer1	463	581	3e-35	PFAM
TSP1	595	648	1.22e-8	SMART
TSP1	649	680	4.85e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family and preproprotein that is proteolytically processed to generate a mature protein product. This secreted protein product plays an important role in ovulation, likely through its cleavage of the extracellular matrix component versican. The encoded protein may enhance tumorigenesis in a mouse model of breast cancer. Homozygous knockout mice for this gene exhibit enhanced perinatal lethality, impaired growth and adipose tissue development, and impaired ovulation in females. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display growth retardation with adipose tissue malformation, impaired female fertility, enlarged renal calices and abnormal adrenal medullary architecture. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Adamts1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Adamts1	APN	16	85795573	missense	probably benign
IGL01753:Adamts1	APN	16	85802224	missense	probably benign	0.00
IGL02238:Adamts1	APN	16	85795825	missense	probably benign	0.01
IGL02655:Adamts1	APN	16	85802617	missense	probably benign
gambler	UTSW	16	85799609	nonsense	probably null
sure_thing	UTSW	16	85798544	missense	probably damaging	1.00
PIT4466001:Adamts1	UTSW	16	85796691	nonsense	probably null
R0114:Adamts1	UTSW	16	85799614	missense	probably benign	0.10
R0135:Adamts1	UTSW	16	85798703	splice site	probably benign
R0179:Adamts1	UTSW	16	85795465	missense	probably benign	0.00
R0517:Adamts1	UTSW	16	85800353	missense	possibly damaging	0.96
R0526:Adamts1	UTSW	16	85802372	missense	probably benign
R0727:Adamts1	UTSW	16	85798648	missense	possibly damaging	0.51
R0899:Adamts1	UTSW	16	85798052	nonsense	probably null
R1163:Adamts1	UTSW	16	85802637	missense	probably benign	0.07
R1555:Adamts1	UTSW	16	85797888	missense	probably benign	0.17
R1598:Adamts1	UTSW	16	85798511	nonsense	probably null
R1643:Adamts1	UTSW	16	85796817	splice site	probably benign
R1847:Adamts1	UTSW	16	85802226	missense	possibly damaging	0.89
R2045:Adamts1	UTSW	16	85795976	missense	probably damaging	1.00
R2093:Adamts1	UTSW	16	85802445	missense	probably benign	0.23
R2966:Adamts1	UTSW	16	85796774	missense	possibly damaging	0.94
R3937:Adamts1	UTSW	16	85795619	missense	possibly damaging	0.90
R3938:Adamts1	UTSW	16	85795619	missense	possibly damaging	0.90
R4348:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4350:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4351:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4352:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4470:Adamts1	UTSW	16	85798516	missense	possibly damaging	0.88
R4724:Adamts1	UTSW	16	85802505	missense	probably benign	0.00
R4775:Adamts1	UTSW	16	85800390	nonsense	probably null
R4972:Adamts1	UTSW	16	85795945	missense	probably damaging	1.00
R5353:Adamts1	UTSW	16	85802608	missense	probably benign	0.00
R5420:Adamts1	UTSW	16	85799609	nonsense	probably null
R5551:Adamts1	UTSW	16	85797746	missense	probably benign
R5574:Adamts1	UTSW	16	85799642	missense	probably damaging	1.00
R5759:Adamts1	UTSW	16	85798048	missense	possibly damaging	0.93
R5860:Adamts1	UTSW	16	85798544	missense	probably damaging	1.00
R5910:Adamts1	UTSW	16	85802149	missense	probably benign	0.00
R6240:Adamts1	UTSW	16	85802157	missense	probably benign
R6473:Adamts1	UTSW	16	85799643	missense	probably damaging	1.00
R6623:Adamts1	UTSW	16	85795637	missense	probably benign	0.20
R6628:Adamts1	UTSW	16	85795825	missense	probably benign	0.05
R7034:Adamts1	UTSW	16	85802746	unclassified	probably benign
R7174:Adamts1	UTSW	16	85799172	missense	probably benign	0.00
R7572:Adamts1	UTSW	16	85797741	missense	possibly damaging	0.51
R7808:Adamts1	UTSW	16	85800229	missense	probably damaging	0.99
R7880:Adamts1	UTSW	16	85798052	nonsense	probably null
R7985:Adamts1	UTSW	16	85798114	missense	probably damaging	1.00
R7986:Adamts1	UTSW	16	85799547	missense	probably damaging	1.00
R8118:Adamts1	UTSW	16	85795933	missense	probably damaging	1.00
R8466:Adamts1	UTSW	16	85802512	missense	probably benign	0.42
R8468:Adamts1	UTSW	16	85795556	missense	possibly damaging	0.52
R8712:Adamts1	UTSW	16	85798008	missense	probably benign	0.28
R8721:Adamts1	UTSW	16	85797887	missense	probably damaging	0.96
R8804:Adamts1	UTSW	16	85802412	missense	probably damaging	1.00
R9188:Adamts1	UTSW	16	85802683	missense	probably damaging	0.96
R9297:Adamts1	UTSW	16	85802646	missense	probably benign	0.01
R9346:Adamts1	UTSW	16	85802532	missense	possibly damaging	0.89
R9552:Adamts1	UTSW	16	85802617	missense	probably benign
R9681:Adamts1	UTSW	16	85802610	missense
R9786:Adamts1	UTSW	16	85795414	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAATCCCAAAGCAAGGAGTTGTTC -3'
(R):5'- CTCTCAGAAACCGGGCAAAG -3'

Sequencing Primer
(F):5'- GTTGTTCCTGCATTTAGAAGTATTCC -3'
(R):5'- GGTTGGAAGTTGGAAACTG -3'

Posted On

2019-11-26