Incidental Mutation 'R7759:Adamts1'
ID 597765
Institutional Source Beutler Lab
Gene Symbol Adamts1
Ensembl Gene ENSMUSG00000022893
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1
Synonyms METH1, ADAMTS-1, ADAM-TS1, METH-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 85793827-85803113 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 85797795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 652 (G652C)
Ref Sequence ENSEMBL: ENSMUSP00000023610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023610] [ENSMUST00000125897]
AlphaFold P97857
Predicted Effect probably damaging
Transcript: ENSMUST00000023610
AA Change: G652C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023610
Gene: ENSMUSG00000022893
AA Change: G652C

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 22 194 1.3e-27 PFAM
Pfam:Reprolysin_4 257 464 2.2e-9 PFAM
Pfam:Reprolysin_5 257 466 1.6e-14 PFAM
Pfam:Reprolysin 259 468 3.6e-22 PFAM
Pfam:Reprolysin_2 279 458 2.1e-10 PFAM
Pfam:Reprolysin_3 281 413 4.8e-14 PFAM
ACR 469 549 7.36e-8 SMART
TSP1 563 615 3.77e-14 SMART
Pfam:ADAM_spacer1 726 844 1.7e-35 PFAM
TSP1 858 911 1.22e-8 SMART
TSP1 912 968 1.2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125897
AA Change: G389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118471
Gene: ENSMUSG00000022893
AA Change: G389C

DomainStartEndE-ValueType
Pfam:Reprolysin_4 1 201 2.3e-9 PFAM
Pfam:Reprolysin_5 1 203 8.8e-14 PFAM
Pfam:Reprolysin 1 205 5e-22 PFAM
Pfam:Reprolysin_2 16 195 8.6e-10 PFAM
Pfam:Reprolysin_3 19 150 4.2e-14 PFAM
ACR 206 286 7.36e-8 SMART
TSP1 300 352 3.77e-14 SMART
Pfam:ADAM_spacer1 463 581 3e-35 PFAM
TSP1 595 648 1.22e-8 SMART
TSP1 649 680 4.85e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family and preproprotein that is proteolytically processed to generate a mature protein product. This secreted protein product plays an important role in ovulation, likely through its cleavage of the extracellular matrix component versican. The encoded protein may enhance tumorigenesis in a mouse model of breast cancer. Homozygous knockout mice for this gene exhibit enhanced perinatal lethality, impaired growth and adipose tissue development, and impaired ovulation in females. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display growth retardation with adipose tissue malformation, impaired female fertility, enlarged renal calices and abnormal adrenal medullary architecture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Adamts1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Adamts1 APN 16 85795573 missense probably benign
IGL01753:Adamts1 APN 16 85802224 missense probably benign 0.00
IGL02238:Adamts1 APN 16 85795825 missense probably benign 0.01
IGL02655:Adamts1 APN 16 85802617 missense probably benign
gambler UTSW 16 85799609 nonsense probably null
sure_thing UTSW 16 85798544 missense probably damaging 1.00
PIT4466001:Adamts1 UTSW 16 85796691 nonsense probably null
R0114:Adamts1 UTSW 16 85799614 missense probably benign 0.10
R0135:Adamts1 UTSW 16 85798703 splice site probably benign
R0179:Adamts1 UTSW 16 85795465 missense probably benign 0.00
R0517:Adamts1 UTSW 16 85800353 missense possibly damaging 0.96
R0526:Adamts1 UTSW 16 85802372 missense probably benign
R0727:Adamts1 UTSW 16 85798648 missense possibly damaging 0.51
R0899:Adamts1 UTSW 16 85798052 nonsense probably null
R1163:Adamts1 UTSW 16 85802637 missense probably benign 0.07
R1555:Adamts1 UTSW 16 85797888 missense probably benign 0.17
R1598:Adamts1 UTSW 16 85798511 nonsense probably null
R1643:Adamts1 UTSW 16 85796817 splice site probably benign
R1847:Adamts1 UTSW 16 85802226 missense possibly damaging 0.89
R2045:Adamts1 UTSW 16 85795976 missense probably damaging 1.00
R2093:Adamts1 UTSW 16 85802445 missense probably benign 0.23
R2966:Adamts1 UTSW 16 85796774 missense possibly damaging 0.94
R3937:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R3938:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R4348:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4350:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4351:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4352:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4470:Adamts1 UTSW 16 85798516 missense possibly damaging 0.88
R4724:Adamts1 UTSW 16 85802505 missense probably benign 0.00
R4775:Adamts1 UTSW 16 85800390 nonsense probably null
R4972:Adamts1 UTSW 16 85795945 missense probably damaging 1.00
R5353:Adamts1 UTSW 16 85802608 missense probably benign 0.00
R5420:Adamts1 UTSW 16 85799609 nonsense probably null
R5551:Adamts1 UTSW 16 85797746 missense probably benign
R5574:Adamts1 UTSW 16 85799642 missense probably damaging 1.00
R5759:Adamts1 UTSW 16 85798048 missense possibly damaging 0.93
R5860:Adamts1 UTSW 16 85798544 missense probably damaging 1.00
R5910:Adamts1 UTSW 16 85802149 missense probably benign 0.00
R6240:Adamts1 UTSW 16 85802157 missense probably benign
R6473:Adamts1 UTSW 16 85799643 missense probably damaging 1.00
R6623:Adamts1 UTSW 16 85795637 missense probably benign 0.20
R6628:Adamts1 UTSW 16 85795825 missense probably benign 0.05
R7034:Adamts1 UTSW 16 85802746 unclassified probably benign
R7174:Adamts1 UTSW 16 85799172 missense probably benign 0.00
R7572:Adamts1 UTSW 16 85797741 missense possibly damaging 0.51
R7808:Adamts1 UTSW 16 85800229 missense probably damaging 0.99
R7880:Adamts1 UTSW 16 85798052 nonsense probably null
R7985:Adamts1 UTSW 16 85798114 missense probably damaging 1.00
R7986:Adamts1 UTSW 16 85799547 missense probably damaging 1.00
R8118:Adamts1 UTSW 16 85795933 missense probably damaging 1.00
R8466:Adamts1 UTSW 16 85802512 missense probably benign 0.42
R8468:Adamts1 UTSW 16 85795556 missense possibly damaging 0.52
R8712:Adamts1 UTSW 16 85798008 missense probably benign 0.28
R8721:Adamts1 UTSW 16 85797887 missense probably damaging 0.96
R8804:Adamts1 UTSW 16 85802412 missense probably damaging 1.00
R9188:Adamts1 UTSW 16 85802683 missense probably damaging 0.96
R9297:Adamts1 UTSW 16 85802646 missense probably benign 0.01
R9346:Adamts1 UTSW 16 85802532 missense possibly damaging 0.89
R9552:Adamts1 UTSW 16 85802617 missense probably benign
R9681:Adamts1 UTSW 16 85802610 missense
R9786:Adamts1 UTSW 16 85795414 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATCCCAAAGCAAGGAGTTGTTC -3'
(R):5'- CTCTCAGAAACCGGGCAAAG -3'

Sequencing Primer
(F):5'- GTTGTTCCTGCATTTAGAAGTATTCC -3'
(R):5'- GGTTGGAAGTTGGAAACTG -3'
Posted On 2019-11-26