Mutagenetix > Incidental Mutation

Incidental Mutation 'R7759:Thbs2'

597766

Institutional Source

Beutler Lab

Gene Symbol

Thbs2

Ensembl Gene

ENSMUSG00000023885

Gene Name

thrombospondin 2

Synonyms

Thbs-2, Thrombospondin-2, TSP2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.289) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14665500-14694235 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14677059 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 729 (E729G)

Ref Sequence

ENSEMBL: ENSMUSP00000128308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170872]

AlphaFold

Q03350

Predicted Effect

probably damaging
Transcript: ENSMUST00000170872
AA Change: E729G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: E729G

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
TSPN	21	215	3.8e-60	SMART
VWC	320	374	3.55e-19	SMART
TSP1	384	431	3.36e-11	SMART
TSP1	440	492	1.35e-15	SMART
TSP1	497	549	8.6e-18	SMART
EGF	552	589	6.3e-3	SMART
EGF	593	647	1.56e1	SMART
EGF	651	692	2.19e-2	SMART
Pfam:TSP_3	729	764	2.5e-12	PFAM
Pfam:TSP_3	763	787	7.4e-7	PFAM
Pfam:TSP_3	788	823	9.4e-12	PFAM
Pfam:TSP_3	823	846	4.1e-7	PFAM
Pfam:TSP_3	847	884	1.7e-12	PFAM
Pfam:TSP_3	885	920	1.3e-11	PFAM
Pfam:TSP_3	921	956	3.1e-11	PFAM
Pfam:TSP_C	974	1171	1e-98	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Thbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Thbs2	APN	17	14668835	missense	probably damaging	1.00
IGL00764:Thbs2	APN	17	14690252	missense	probably damaging	0.98
IGL01370:Thbs2	APN	17	14690065	missense	possibly damaging	0.82
IGL01604:Thbs2	APN	17	14678769	missense	probably benign	0.31
IGL01936:Thbs2	APN	17	14687814	missense	probably benign	0.00
IGL02061:Thbs2	APN	17	14679914	missense	probably benign	0.35
IGL02255:Thbs2	APN	17	14689785	missense	probably benign	0.00
IGL02342:Thbs2	APN	17	14676316	missense	probably damaging	1.00
IGL02402:Thbs2	APN	17	14671454	missense	probably benign	0.01
IGL02499:Thbs2	APN	17	14684066	splice site	probably benign
IGL02572:Thbs2	APN	17	14677013	missense	possibly damaging	0.72
IGL02701:Thbs2	APN	17	14683361	missense	probably benign	0.05
IGL02871:Thbs2	APN	17	14685786	missense	probably benign
IGL03058:Thbs2	APN	17	14689969	missense	possibly damaging	0.91
IGL03185:Thbs2	APN	17	14681410	nonsense	probably null
IGL03232:Thbs2	APN	17	14691413	start codon destroyed	probably null
IGL03289:Thbs2	APN	17	14690122	missense	probably benign	0.00
IGL03407:Thbs2	APN	17	14673273	missense	probably benign	0.00
H8562:Thbs2	UTSW	17	14671453	missense	probably benign	0.00
IGL02802:Thbs2	UTSW	17	14684127	missense	probably benign	0.01
PIT4354001:Thbs2	UTSW	17	14689968	missense	probably damaging	0.99
R0088:Thbs2	UTSW	17	14681701	missense	possibly damaging	0.96
R0167:Thbs2	UTSW	17	14667525	splice site	probably benign
R0415:Thbs2	UTSW	17	14679973	missense	probably benign
R0658:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R0735:Thbs2	UTSW	17	14679815	missense	probably benign	0.00
R1582:Thbs2	UTSW	17	14671288	missense	probably damaging	1.00
R1585:Thbs2	UTSW	17	14689768	missense	probably benign	0.00
R1608:Thbs2	UTSW	17	14685781	missense	probably benign
R1721:Thbs2	UTSW	17	14678810	missense	probably benign	0.00
R1724:Thbs2	UTSW	17	14685900	missense	possibly damaging	0.80
R1791:Thbs2	UTSW	17	14685813	missense	probably benign
R1816:Thbs2	UTSW	17	14670713	missense	probably benign	0.01
R1816:Thbs2	UTSW	17	14670714	missense	probably benign	0.00
R1911:Thbs2	UTSW	17	14689842	missense	probably benign	0.38
R2137:Thbs2	UTSW	17	14673306	missense	probably damaging	1.00
R2152:Thbs2	UTSW	17	14673209	missense	probably damaging	1.00
R2244:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R2325:Thbs2	UTSW	17	14690289	splice site	probably null
R2509:Thbs2	UTSW	17	14685843	missense	probably benign	0.11
R3838:Thbs2	UTSW	17	14687851	missense	probably benign
R4173:Thbs2	UTSW	17	14681631	splice site	probably null
R4427:Thbs2	UTSW	17	14680335	missense	probably benign
R4495:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R4789:Thbs2	UTSW	17	14671488	missense	probably damaging	1.00
R4928:Thbs2	UTSW	17	14678900	missense	probably damaging	1.00
R5058:Thbs2	UTSW	17	14676329	missense	probably damaging	1.00
R5112:Thbs2	UTSW	17	14670590	splice site	probably null
R5619:Thbs2	UTSW	17	14681244	missense	probably damaging	1.00
R5649:Thbs2	UTSW	17	14689953	missense	probably damaging	1.00
R5664:Thbs2	UTSW	17	14689837	missense	probably damaging	1.00
R5801:Thbs2	UTSW	17	14687863	missense	probably damaging	1.00
R5816:Thbs2	UTSW	17	14684071	critical splice donor site	probably null
R5840:Thbs2	UTSW	17	14681430	splice site	probably null
R6149:Thbs2	UTSW	17	14679680	critical splice donor site	probably null
R6166:Thbs2	UTSW	17	14680388	missense	probably damaging	1.00
R6412:Thbs2	UTSW	17	14677077	missense	probably damaging	1.00
R6473:Thbs2	UTSW	17	14685796	missense	probably benign	0.23
R6640:Thbs2	UTSW	17	14673368	missense	possibly damaging	0.94
R6695:Thbs2	UTSW	17	14674164	missense	possibly damaging	0.54
R6711:Thbs2	UTSW	17	14690265	missense	probably benign	0.00
R6947:Thbs2	UTSW	17	14689767	missense	possibly damaging	0.79
R6962:Thbs2	UTSW	17	14681820	missense	probably benign	0.00
R7183:Thbs2	UTSW	17	14690116	missense	possibly damaging	0.90
R7203:Thbs2	UTSW	17	14671458	missense	probably damaging	1.00
R7386:Thbs2	UTSW	17	14673150	missense	possibly damaging	0.95
R7621:Thbs2	UTSW	17	14674164	missense	probably benign
R7747:Thbs2	UTSW	17	14670039	missense	possibly damaging	0.94
R7800:Thbs2	UTSW	17	14676296	missense	probably damaging	1.00
R7895:Thbs2	UTSW	17	14676221	missense	probably damaging	1.00
R8094:Thbs2	UTSW	17	14680322	missense	probably benign	0.00
R8332:Thbs2	UTSW	17	14679770	missense	probably damaging	1.00
R8478:Thbs2	UTSW	17	14680404	missense	probably benign	0.00
R8695:Thbs2	UTSW	17	14679701	missense	probably benign
R8707:Thbs2	UTSW	17	14691383	missense	probably damaging	1.00
R9001:Thbs2	UTSW	17	14668745	missense	probably damaging	1.00
R9075:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R9183:Thbs2	UTSW	17	14676264	missense	probably benign	0.03
R9461:Thbs2	UTSW	17	14690173	missense	probably damaging	1.00
R9462:Thbs2	UTSW	17	14669981	missense	probably damaging	1.00
R9536:Thbs2	UTSW	17	14689885	missense	probably damaging	1.00
R9592:Thbs2	UTSW	17	14678821	missense	probably damaging	1.00
S24628:Thbs2	UTSW	17	14679973	missense	probably benign
X0025:Thbs2	UTSW	17	14681800	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCTGTGCACCCACTAATCAG -3'
(R):5'- GGTAGGACTCAGAACAGCACAC -3'

Sequencing Primer
(F):5'- GCACCCACTAATCAGTATTTTCAGGG -3'
(R):5'- ACACGTCCAGGACAGCTG -3'

Posted On

2019-11-26