Mutagenetix > Incidental Mutations

Incidental Mutation 'R7759:Ubr2'

597768

Institutional Source

Beutler Lab

Gene Symbol

Ubr2

Ensembl Gene

ENSMUSG00000023977

Gene Name

ubiquitin protein ligase E3 component n-recognin 2

Synonyms

9930021A08Rik, E130209G04Rik, ENSMUSG00000043296

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.903) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46928295-47010556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 46986048 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 269 (R269C)

Ref Sequence

ENSEMBL: ENSMUSP00000108961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]

Predicted Effect

probably damaging
Transcript: ENSMUST00000113335
AA Change: R269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: R269C

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	221	302	2.4e-23	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113337
AA Change: R269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: R269C

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	222	301	6.2e-26	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225599

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Ubr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ubr2	APN	17	46986060	splice site	probably benign
IGL00332:Ubr2	APN	17	46990990	critical splice donor site	probably null
IGL00518:Ubr2	APN	17	46992996	missense	probably damaging	1.00
IGL00693:Ubr2	APN	17	46972981	missense	probably benign	0.01
IGL00785:Ubr2	APN	17	46944865	missense	possibly damaging	0.69
IGL01144:Ubr2	APN	17	46957321	missense	probably damaging	1.00
IGL01459:Ubr2	APN	17	46930509	splice site	probably benign
IGL01637:Ubr2	APN	17	46956654	missense	probably damaging	1.00
IGL01710:Ubr2	APN	17	46943409	missense	probably benign	0.00
IGL01726:Ubr2	APN	17	46992981	splice site	probably benign
IGL01925:Ubr2	APN	17	46954949	missense	possibly damaging	0.92
IGL01960:Ubr2	APN	17	46973967	missense	probably benign	0.45
IGL02170:Ubr2	APN	17	46967197	missense	probably benign	0.05
IGL02308:Ubr2	APN	17	46934193	missense	probably damaging	1.00
IGL02387:Ubr2	APN	17	46963150	missense	probably benign
IGL02696:Ubr2	APN	17	46963765	missense	probably benign
IGL02726:Ubr2	APN	17	46972921	missense	probably damaging	1.00
IGL02750:Ubr2	APN	17	46969282	missense	probably benign	0.00
IGL02934:Ubr2	APN	17	46957340	missense	possibly damaging	0.50
IGL02959:Ubr2	APN	17	46975951	missense	probably damaging	0.96
IGL03018:Ubr2	APN	17	46954046	missense	possibly damaging	0.64
IGL03343:Ubr2	APN	17	46951918	missense	probably benign	0.00
PIT4280001:Ubr2	UTSW	17	46944863	missense	probably damaging	1.00
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0446:Ubr2	UTSW	17	46983298	missense	probably damaging	1.00
R0513:Ubr2	UTSW	17	46986779	nonsense	probably null
R0565:Ubr2	UTSW	17	46955886	missense	probably damaging	1.00
R0600:Ubr2	UTSW	17	46967248	missense	probably damaging	0.99
R0690:Ubr2	UTSW	17	46938653	missense	probably damaging	0.97
R0710:Ubr2	UTSW	17	46938681	missense	probably damaging	0.96
R0761:Ubr2	UTSW	17	46983316	missense	probably damaging	1.00
R0798:Ubr2	UTSW	17	46969176	splice site	probably benign
R0862:Ubr2	UTSW	17	46967083	nonsense	probably null
R0947:Ubr2	UTSW	17	46941112	missense	probably damaging	0.99
R0972:Ubr2	UTSW	17	46934261	splice site	probably null
R1500:Ubr2	UTSW	17	46986689	missense	possibly damaging	0.79
R1514:Ubr2	UTSW	17	47000823	missense	probably damaging	1.00
R1533:Ubr2	UTSW	17	46967247	nonsense	probably null
R1554:Ubr2	UTSW	17	46972951	missense	probably benign
R1575:Ubr2	UTSW	17	46932492	missense	probably damaging	1.00
R1602:Ubr2	UTSW	17	46941061	missense	probably benign	0.30
R1941:Ubr2	UTSW	17	46974026	missense	probably damaging	1.00
R1966:Ubr2	UTSW	17	46954919	missense	probably benign	0.05
R2041:Ubr2	UTSW	17	46986047	missense	probably damaging	1.00
R2067:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2111:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2189:Ubr2	UTSW	17	46943364	missense	probably benign	0.01
R2219:Ubr2	UTSW	17	46986042	missense	possibly damaging	0.94
R2307:Ubr2	UTSW	17	46966215	nonsense	probably null
R3426:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3428:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3608:Ubr2	UTSW	17	46944523	missense	probably damaging	1.00
R4080:Ubr2	UTSW	17	46988722	missense	probably benign	0.05
R4330:Ubr2	UTSW	17	46967278	missense	probably null	1.00
R4383:Ubr2	UTSW	17	46939387	missense	probably benign	0.01
R4460:Ubr2	UTSW	17	46945045	critical splice donor site	probably null
R4794:Ubr2	UTSW	17	46930445	missense	probably damaging	1.00
R4902:Ubr2	UTSW	17	46985996	missense	possibly damaging	0.91
R4913:Ubr2	UTSW	17	46959459	splice site	probably null
R5092:Ubr2	UTSW	17	46969247	missense	probably damaging	1.00
R5209:Ubr2	UTSW	17	46968424	missense	probably damaging	1.00
R5226:Ubr2	UTSW	17	46983270	missense	probably benign	0.04
R5250:Ubr2	UTSW	17	46930442	missense	probably benign	0.01
R5437:Ubr2	UTSW	17	46963697	missense	probably benign	0.00
R5607:Ubr2	UTSW	17	46934200	nonsense	probably null
R5848:Ubr2	UTSW	17	46956655	missense	possibly damaging	0.84
R6089:Ubr2	UTSW	17	46982292	missense	possibly damaging	0.95
R6382:Ubr2	UTSW	17	46957315	missense	possibly damaging	0.56
R6552:Ubr2	UTSW	17	46966268	splice site	probably null
R6630:Ubr2	UTSW	17	46951984	missense	possibly damaging	0.51
R6892:Ubr2	UTSW	17	46934108	missense	probably damaging	0.99
R6936:Ubr2	UTSW	17	46973031	missense	possibly damaging	0.94
R7039:Ubr2	UTSW	17	47010213	missense	probably benign	0.01
R7050:Ubr2	UTSW	17	46961602	missense	probably benign	0.30
R7078:Ubr2	UTSW	17	46955853	missense	possibly damaging	0.59
R7126:Ubr2	UTSW	17	46974056	splice site	probably null
R7219:Ubr2	UTSW	17	46935434	nonsense	probably null
R7262:Ubr2	UTSW	17	47000739	missense	probably damaging	0.97
R7352:Ubr2	UTSW	17	46930426	missense	probably benign	0.19
R7366:Ubr2	UTSW	17	46955845	missense	probably damaging	0.99
R7449:Ubr2	UTSW	17	46964788	missense	probably damaging	1.00
R7496:Ubr2	UTSW	17	46990991	critical splice donor site	probably null
R7869:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
R7916:Ubr2	UTSW	17	46968382	critical splice donor site	probably null
R8236:Ubr2	UTSW	17	46951909	missense	probably benign
R8376:Ubr2	UTSW	17	46942795	missense	probably benign	0.07
X0027:Ubr2	UTSW	17	47000629	missense	probably damaging	0.99
X0061:Ubr2	UTSW	17	46970111	missense	possibly damaging	0.88
Z1177:Ubr2	UTSW	17	46959509	missense	probably benign
Z1177:Ubr2	UTSW	17	47000766	missense	possibly damaging	0.76
Z1177:Ubr2	UTSW	17	47010143	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- ACAGCTCACGTGATACTGGAC -3'
(R):5'- CGAGAATAAATGACCTGTCGTGAG -3'

Sequencing Primer
(F):5'- TCACGTGATACTGGACGCATG -3'
(R):5'- TGACCTGTCGTGAGAGTAAAACAC -3'

Posted On

2019-11-26