Incidental Mutation 'R7759:Ubr2'
ID 597768
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms ENSMUSG00000043296, E130209G04Rik, 9930021A08Rik
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 47239221-47321482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47296974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 269 (R269C)
Ref Sequence ENSEMBL: ENSMUSP00000108961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]
AlphaFold Q6WKZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000113335
AA Change: R269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: R269C

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113337
AA Change: R269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: R269C

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225599
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,682,514 (GRCm39) G215V probably benign Het
Adamts1 C A 16: 85,594,683 (GRCm39) G652C probably damaging Het
Adck1 G A 12: 88,368,887 (GRCm39) A122T possibly damaging Het
Akap1 A C 11: 88,736,659 (GRCm39) M34R probably damaging Het
Apc2 C T 10: 80,147,030 (GRCm39) R695C probably damaging Het
Apon T A 10: 128,090,384 (GRCm39) W21R probably benign Het
Arhgef16 T C 4: 154,371,432 (GRCm39) T254A probably benign Het
Arid5b T A 10: 67,933,632 (GRCm39) S757C probably damaging Het
B020004C17Rik A C 14: 57,254,242 (GRCm39) I122L possibly damaging Het
Bckdhb T G 9: 83,892,379 (GRCm39) V270G probably damaging Het
Cacna1d A G 14: 29,821,145 (GRCm39) Y1146H probably benign Het
Carmil2 A G 8: 106,423,668 (GRCm39) D1214G possibly damaging Het
Ccdc142 T C 6: 83,084,912 (GRCm39) V636A probably benign Het
Chd9 T C 8: 91,704,178 (GRCm39) probably null Het
Csmd3 A G 15: 47,561,569 (GRCm39) S1336P Het
Cubn A G 2: 13,352,961 (GRCm39) Y1926H probably damaging Het
Dock4 A T 12: 40,867,735 (GRCm39) D1437V probably damaging Het
Eme1 A T 11: 94,536,666 (GRCm39) Y504* probably null Het
Enah G A 1: 181,746,009 (GRCm39) A687V unknown Het
Endou A C 15: 97,611,747 (GRCm39) V339G probably damaging Het
Ephb6 G A 6: 41,591,539 (GRCm39) R232H probably benign Het
Ephx2 G A 14: 66,326,968 (GRCm39) A409V possibly damaging Het
Esd T A 14: 74,983,007 (GRCm39) C219* probably null Het
Fscb A T 12: 64,520,866 (GRCm39) M200K probably benign Het
Gabra6 A T 11: 42,208,508 (GRCm39) V108D probably damaging Het
Gm11555 A G 11: 99,540,568 (GRCm39) V137A unknown Het
Gpld1 A G 13: 25,146,383 (GRCm39) D209G probably damaging Het
Ikzf1 T A 11: 11,719,256 (GRCm39) I408N probably damaging Het
Itgb4 A G 11: 115,894,536 (GRCm39) R1364G possibly damaging Het
Kif26b A C 1: 178,506,509 (GRCm39) K195T probably damaging Het
Mfsd12 T C 10: 81,199,427 (GRCm39) W440R probably benign Het
Mtrr C T 13: 68,718,146 (GRCm39) E373K probably damaging Het
Mug2 T A 6: 122,058,317 (GRCm39) V1293E probably damaging Het
Myof C A 19: 37,928,346 (GRCm39) A1068S probably benign Het
Ncam2 A G 16: 81,412,672 (GRCm39) D720G probably damaging Het
Nova2 G T 7: 18,692,176 (GRCm39) G435V Het
Oacyl T A 18: 65,843,631 (GRCm39) D109E probably damaging Het
Or2y1g A T 11: 49,171,463 (GRCm39) M163L probably benign Het
Or56a4 G A 7: 104,806,232 (GRCm39) S219F probably damaging Het
Pdcd11 G A 19: 47,101,637 (GRCm39) V941M possibly damaging Het
Pdzd8 C A 19: 59,288,358 (GRCm39) R1014L probably damaging Het
Ppm1h T G 10: 122,740,018 (GRCm39) D364E probably benign Het
Rigi C A 4: 40,225,104 (GRCm39) A298S probably damaging Het
Rp1 T C 1: 4,415,107 (GRCm39) N2002D probably benign Het
Sall1 C T 8: 89,768,979 (GRCm39) probably null Het
Scn10a C T 9: 119,477,198 (GRCm39) W728* probably null Het
Setdb2 G T 14: 59,656,813 (GRCm39) T168K probably damaging Het
Sgms1 T C 19: 32,137,276 (GRCm39) I97V probably benign Het
Slc8a3 A T 12: 81,361,325 (GRCm39) M498K probably benign Het
Smpd4 A T 16: 17,456,497 (GRCm39) E362D probably damaging Het
Ssc5d A T 7: 4,940,529 (GRCm39) K881* probably null Het
Strn4 A G 7: 16,564,309 (GRCm39) E313G probably damaging Het
Tas2r113 A T 6: 132,870,890 (GRCm39) N306I possibly damaging Het
Tdrd6 G T 17: 43,935,730 (GRCm39) R1773S probably benign Het
Thbs2 T C 17: 14,897,321 (GRCm39) E729G probably damaging Het
Tnfrsf23 G A 7: 143,224,572 (GRCm39) T135I probably damaging Het
Tollip A G 7: 141,438,276 (GRCm39) M218T probably benign Het
Tyk2 A T 9: 21,031,554 (GRCm39) probably null Het
Uggt1 A T 1: 36,185,806 (GRCm39) M1459K possibly damaging Het
Upf1 A G 8: 70,786,730 (GRCm39) V929A probably benign Het
Usp48 T C 4: 137,321,763 (GRCm39) S24P probably benign Het
Vmn1r214 G A 13: 23,218,631 (GRCm39) E42K not run Het
Vmn1r83 G T 7: 12,055,360 (GRCm39) D232E probably benign Het
Vmn2r25 C T 6: 123,800,339 (GRCm39) V668I probably damaging Het
Vmn2r6 A G 3: 64,463,991 (GRCm39) I281T probably damaging Het
Ywhag A T 5: 135,940,043 (GRCm39) Y184N probably damaging Het
Zdbf2 A C 1: 63,347,535 (GRCm39) E1971D possibly damaging Het
Zfp568 G A 7: 29,722,839 (GRCm39) A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 (GRCm39) D248G probably benign Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 47,296,986 (GRCm39) splice site probably benign
IGL00332:Ubr2 APN 17 47,301,916 (GRCm39) critical splice donor site probably null
IGL00518:Ubr2 APN 17 47,303,922 (GRCm39) missense probably damaging 1.00
IGL00693:Ubr2 APN 17 47,283,907 (GRCm39) missense probably benign 0.01
IGL00785:Ubr2 APN 17 47,255,791 (GRCm39) missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 47,268,247 (GRCm39) missense probably damaging 1.00
IGL01459:Ubr2 APN 17 47,241,435 (GRCm39) splice site probably benign
IGL01637:Ubr2 APN 17 47,267,580 (GRCm39) missense probably damaging 1.00
IGL01710:Ubr2 APN 17 47,254,335 (GRCm39) missense probably benign 0.00
IGL01726:Ubr2 APN 17 47,303,907 (GRCm39) splice site probably benign
IGL01925:Ubr2 APN 17 47,265,875 (GRCm39) missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 47,284,893 (GRCm39) missense probably benign 0.45
IGL02170:Ubr2 APN 17 47,278,123 (GRCm39) missense probably benign 0.05
IGL02308:Ubr2 APN 17 47,245,119 (GRCm39) missense probably damaging 1.00
IGL02387:Ubr2 APN 17 47,274,076 (GRCm39) missense probably benign
IGL02696:Ubr2 APN 17 47,274,691 (GRCm39) missense probably benign
IGL02726:Ubr2 APN 17 47,283,847 (GRCm39) missense probably damaging 1.00
IGL02750:Ubr2 APN 17 47,280,208 (GRCm39) missense probably benign 0.00
IGL02934:Ubr2 APN 17 47,268,266 (GRCm39) missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 47,286,877 (GRCm39) missense probably damaging 0.96
IGL03018:Ubr2 APN 17 47,264,972 (GRCm39) missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 47,262,844 (GRCm39) missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 47,255,789 (GRCm39) missense probably damaging 1.00
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0446:Ubr2 UTSW 17 47,294,224 (GRCm39) missense probably damaging 1.00
R0513:Ubr2 UTSW 17 47,297,705 (GRCm39) nonsense probably null
R0565:Ubr2 UTSW 17 47,266,812 (GRCm39) missense probably damaging 1.00
R0600:Ubr2 UTSW 17 47,278,174 (GRCm39) missense probably damaging 0.99
R0690:Ubr2 UTSW 17 47,249,579 (GRCm39) missense probably damaging 0.97
R0710:Ubr2 UTSW 17 47,249,607 (GRCm39) missense probably damaging 0.96
R0761:Ubr2 UTSW 17 47,294,242 (GRCm39) missense probably damaging 1.00
R0798:Ubr2 UTSW 17 47,280,102 (GRCm39) splice site probably benign
R0862:Ubr2 UTSW 17 47,278,009 (GRCm39) nonsense probably null
R0947:Ubr2 UTSW 17 47,252,038 (GRCm39) missense probably damaging 0.99
R0972:Ubr2 UTSW 17 47,245,187 (GRCm39) splice site probably null
R1500:Ubr2 UTSW 17 47,297,615 (GRCm39) missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47,311,749 (GRCm39) missense probably damaging 1.00
R1533:Ubr2 UTSW 17 47,278,173 (GRCm39) nonsense probably null
R1554:Ubr2 UTSW 17 47,283,877 (GRCm39) missense probably benign
R1575:Ubr2 UTSW 17 47,243,418 (GRCm39) missense probably damaging 1.00
R1602:Ubr2 UTSW 17 47,251,987 (GRCm39) missense probably benign 0.30
R1941:Ubr2 UTSW 17 47,284,952 (GRCm39) missense probably damaging 1.00
R1966:Ubr2 UTSW 17 47,265,845 (GRCm39) missense probably benign 0.05
R2041:Ubr2 UTSW 17 47,296,973 (GRCm39) missense probably damaging 1.00
R2067:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2111:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2189:Ubr2 UTSW 17 47,254,290 (GRCm39) missense probably benign 0.01
R2219:Ubr2 UTSW 17 47,296,968 (GRCm39) missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 47,277,141 (GRCm39) nonsense probably null
R3426:Ubr2 UTSW 17 47,279,365 (GRCm39) missense probably damaging 1.00
R3428:Ubr2 UTSW 17 47,279,365 (GRCm39) missense probably damaging 1.00
R3608:Ubr2 UTSW 17 47,255,449 (GRCm39) missense probably damaging 1.00
R4080:Ubr2 UTSW 17 47,299,648 (GRCm39) missense probably benign 0.05
R4330:Ubr2 UTSW 17 47,278,204 (GRCm39) missense probably null 1.00
R4383:Ubr2 UTSW 17 47,250,313 (GRCm39) missense probably benign 0.01
R4460:Ubr2 UTSW 17 47,255,971 (GRCm39) critical splice donor site probably null
R4794:Ubr2 UTSW 17 47,241,371 (GRCm39) missense probably damaging 1.00
R4902:Ubr2 UTSW 17 47,296,922 (GRCm39) missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 47,270,385 (GRCm39) splice site probably null
R5092:Ubr2 UTSW 17 47,280,173 (GRCm39) missense probably damaging 1.00
R5209:Ubr2 UTSW 17 47,279,350 (GRCm39) missense probably damaging 1.00
R5226:Ubr2 UTSW 17 47,294,196 (GRCm39) missense probably benign 0.04
R5250:Ubr2 UTSW 17 47,241,368 (GRCm39) missense probably benign 0.01
R5437:Ubr2 UTSW 17 47,274,623 (GRCm39) missense probably benign 0.00
R5607:Ubr2 UTSW 17 47,245,126 (GRCm39) nonsense probably null
R5848:Ubr2 UTSW 17 47,267,581 (GRCm39) missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 47,293,218 (GRCm39) missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 47,268,241 (GRCm39) missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 47,277,194 (GRCm39) splice site probably null
R6630:Ubr2 UTSW 17 47,262,910 (GRCm39) missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 47,245,034 (GRCm39) missense probably damaging 0.99
R6936:Ubr2 UTSW 17 47,283,957 (GRCm39) missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47,321,139 (GRCm39) missense probably benign 0.01
R7050:Ubr2 UTSW 17 47,272,528 (GRCm39) missense probably benign 0.30
R7078:Ubr2 UTSW 17 47,266,779 (GRCm39) missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 47,284,982 (GRCm39) splice site probably null
R7219:Ubr2 UTSW 17 47,246,360 (GRCm39) nonsense probably null
R7262:Ubr2 UTSW 17 47,311,665 (GRCm39) missense probably damaging 0.97
R7352:Ubr2 UTSW 17 47,241,352 (GRCm39) missense probably benign 0.19
R7366:Ubr2 UTSW 17 47,266,771 (GRCm39) missense probably damaging 0.99
R7449:Ubr2 UTSW 17 47,275,714 (GRCm39) missense probably damaging 1.00
R7496:Ubr2 UTSW 17 47,301,917 (GRCm39) critical splice donor site probably null
R7869:Ubr2 UTSW 17 47,301,934 (GRCm39) missense probably benign 0.00
R7916:Ubr2 UTSW 17 47,279,308 (GRCm39) critical splice donor site probably null
R8236:Ubr2 UTSW 17 47,262,835 (GRCm39) missense probably benign
R8376:Ubr2 UTSW 17 47,253,721 (GRCm39) missense probably benign 0.07
R9026:Ubr2 UTSW 17 47,245,041 (GRCm39) missense probably damaging 1.00
R9216:Ubr2 UTSW 17 47,292,285 (GRCm39) missense probably benign 0.36
R9339:Ubr2 UTSW 17 47,284,865 (GRCm39) missense probably benign 0.30
R9558:Ubr2 UTSW 17 47,262,843 (GRCm39) missense probably benign
R9606:Ubr2 UTSW 17 47,245,020 (GRCm39) missense probably damaging 1.00
R9644:Ubr2 UTSW 17 47,266,706 (GRCm39) critical splice donor site probably null
R9731:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
X0027:Ubr2 UTSW 17 47,311,555 (GRCm39) missense probably damaging 0.99
X0061:Ubr2 UTSW 17 47,281,037 (GRCm39) missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 47,311,692 (GRCm39) missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47,270,435 (GRCm39) missense probably benign
Z1177:Ubr2 UTSW 17 47,321,069 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACAGCTCACGTGATACTGGAC -3'
(R):5'- CGAGAATAAATGACCTGTCGTGAG -3'

Sequencing Primer
(F):5'- TCACGTGATACTGGACGCATG -3'
(R):5'- TGACCTGTCGTGAGAGTAAAACAC -3'
Posted On 2019-11-26