Incidental Mutation 'R7759:Pdzd8'
ID597773
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7759 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59299926 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1014 (R1014L)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: R1014L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: R1014L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTCCCGATTTAGCTAAAGCAG -3'
(R):5'- CGTCAAGTCTCTAAAACTCGCC -3'

Sequencing Primer
(F):5'- GCAGCAGAAAGAACTGACTTTTTCC -3'
(R):5'- CCTTTCTGAACCAGGAACAGATCTTG -3'
Posted On2019-11-26