Mutagenetix > Incidental Mutations

Incidental Mutation 'R7760:Dnah7b'

597775

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

Dnahc7b, LOC227058

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R7760 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46066315-46373546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46201253 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1510 (L1510Q)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069293
AA Change: L1510Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: L1510Q

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anxa11	C	T	14: 25,872,827	Q162*	probably null	Het
Arg1	T	G	10: 24,927,463		probably benign	Het
Arl6	T	C	16: 59,618,806	D175G	probably damaging	Het
Capg	A	G	6: 72,557,786	R199G	probably damaging	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Ceacam1	T	A	7: 25,472,025	E338V	probably damaging	Het
Clec4d	A	G	6: 123,270,341	N148D	probably benign	Het
Ctr9	T	G	7: 111,046,601	I653R	probably damaging	Het
Dmwd	C	T	7: 19,080,735	L437F	probably damaging	Het
Efcab5	T	A	11: 77,151,926	E136D	probably benign	Het
Elfn2	C	T	15: 78,673,841	A169T	probably benign	Het
Esrp2	T	A	8: 106,133,470	E326D	probably benign	Het
Fbrs	T	C	7: 127,489,400	V718A	probably damaging	Het
Fbxl21	T	C	13: 56,526,934	S33P	probably benign	Het
Fbxl21	C	T	13: 56,537,003	R307C	probably benign	Het
Gatad2b	C	T	3: 90,354,469	R461W	probably damaging	Het
Gm19410	T	A	8: 35,802,337	C1109S	probably damaging	Het
Gm6882	T	A	7: 21,427,484	D153V	probably damaging	Het
Gm7075	T	C	10: 63,421,537	K68R	probably damaging	Het
Golga3	A	G	5: 110,205,850	E918G	probably benign	Het
Greb1	T	C	12: 16,723,416	N219S	probably benign	Het
Grpel1	G	T	5: 36,470,642	R89L	probably damaging	Het
Ighv5-12	T	A	12: 113,702,175	Q101L	probably benign	Het
Ikbkap	A	G	4: 56,790,892	V287A	probably benign	Het
Ldb3	T	A	14: 34,542,503	N590I	probably damaging	Het
Man2c1	T	C	9: 57,139,363	V636A	probably benign	Het
Mblac2	G	T	13: 81,711,877	V117L	probably benign	Het
Nfatc3	A	G	8: 106,108,341	E773G	possibly damaging	Het
Ngef	T	C	1: 87,540,773	D88G	probably benign	Het
Nipbl	T	C	15: 8,358,702	E478G	probably damaging	Het
Olfr720	T	C	14: 14,175,905	Y59C	probably damaging	Het
Pbx4	C	A	8: 69,832,795	D29E	probably benign	Het
Pcdhgb5	A	G	18: 37,731,637	I162V	not run	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pigr	A	T	1: 130,846,631	R449S	possibly damaging	Het
Plcb2	T	C	2: 118,711,388	T914A	probably benign	Het
Ppp5c	A	G	7: 17,006,349	S387P	probably damaging	Het
Rtkn2	T	G	10: 68,005,609	S196A	probably damaging	Het
Sec31a	A	G	5: 100,392,628	F400L	probably damaging	Het
Senp7	A	T	16: 56,139,079	M251L	probably benign	Het
Slc6a5	T	C	7: 49,946,617	F612L	probably benign	Het
Slc7a9	T	C	7: 35,457,075	I314T	possibly damaging	Het
Smc5	A	C	19: 23,235,890	S553A	probably benign	Het
Spaca3	T	A	11: 80,864,563	V133D	probably damaging	Het
Taco1	T	A	11: 106,073,112	D232E	possibly damaging	Het
Tarbp1	C	T	8: 126,452,807	R664H	not run	Het
Tlk2	T	C	11: 105,279,167	I674T	probably damaging	Het
Tnxb	A	T	17: 34,712,937	E2148V	probably damaging	Het
Tom1l2	T	C	11: 60,274,965	S59G	probably benign	Het
Traj46	A	T	14: 54,172,356	H7L		Het
Traj46	T	G	14: 54,172,357	H7Q		Het
Trav6-4	T	A	14: 53,454,646	L70Q	possibly damaging	Het
Trmt1l	C	T	1: 151,442,674	T245I	possibly damaging	Het
Wac	T	A	18: 7,921,913	C601S	probably benign	Het
Wnt3	T	A	11: 103,811,440	H145Q	probably benign	Het
Zfp948	T	C	17: 21,588,366	C607R	probably damaging	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46142149	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46211337	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46224651	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46066729	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46214322	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46195378	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46081432	splice site	probably benign
IGL01392:Dnah7b	APN	1	46126788	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46116300	splice site	probably benign
IGL01460:Dnah7b	APN	1	46139704	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46268653	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46358147	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46358137	nonsense	probably null
IGL01906:Dnah7b	APN	1	46175453	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46124337	splice site	probably benign
IGL01989:Dnah7b	APN	1	46289534	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46139875	missense	probably benign
IGL02213:Dnah7b	APN	1	46233592	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46226930	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46099503	nonsense	probably null
IGL02381:Dnah7b	APN	1	46277120	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46234193	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46195318	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46123777	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46116301	splice site	probably benign
IGL02704:Dnah7b	APN	1	46142133	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46099608	splice site	probably benign
IGL02745:Dnah7b	APN	1	46195029	splice site	probably benign
IGL02818:Dnah7b	APN	1	46290808	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46119298	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46182375	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46085689	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46119304	missense	probably benign	0.18
PIT4305001:Dnah7b	UTSW	1	46373348	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46213360	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46223178	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46219348	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46123777	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46207643	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46134656	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46240944	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46277126	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46236788	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46140176	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46219544	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46240992	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46340132	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46099612	splice site	probably benign
R1035:Dnah7b	UTSW	1	46124448	missense	probably benign
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46325810	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46340120	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46099509	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46289656	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46078593	splice site	probably benign
R1484:Dnah7b	UTSW	1	46137543	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46177281	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46066797	missense	unknown
R1607:Dnah7b	UTSW	1	46290646	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46352966	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46175390	nonsense	probably null
R1681:Dnah7b	UTSW	1	46324712	nonsense	probably null
R1716:Dnah7b	UTSW	1	46191783	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46233759	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46116177	missense	probably benign	0.04
R1838:Dnah7b	UTSW	1	46277105	missense	probably damaging	1.00
R1898:Dnah7b	UTSW	1	46236714	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46242103	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46142087	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46242321	nonsense	probably null
R2083:Dnah7b	UTSW	1	46241067	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46097992	splice site	probably benign
R2172:Dnah7b	UTSW	1	46124512	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46201184	splice site	probably benign
R2247:Dnah7b	UTSW	1	46277063	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46233915	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46362954	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46195287	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46139741	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46207572	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46188687	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46182423	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46268709	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46352873	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46299875	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46243257	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46137485	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46233711	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46081495	missense	probably benign
R4172:Dnah7b	UTSW	1	46226946	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46137418	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46221772	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46337594	splice site	probably null
R4414:Dnah7b	UTSW	1	46126680	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46085632	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46289536	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46078524	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46217157	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46211328	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46207656	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46066955	missense	unknown
R4780:Dnah7b	UTSW	1	46353014	missense	probably benign
R4828:Dnah7b	UTSW	1	46128112	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46356602	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46195074	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46081444	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46201318	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46290775	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46233726	missense	probably benign
R5000:Dnah7b	UTSW	1	46099503	nonsense	probably null
R5005:Dnah7b	UTSW	1	46242028	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46187363	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46182380	nonsense	probably null
R5174:Dnah7b	UTSW	1	46243349	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46358216	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46233858	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46373354	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46233689	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46217191	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46188659	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46358271	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46242206	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46242019	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46109312	missense	probably null
R5479:Dnah7b	UTSW	1	46223105	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46242199	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46356514	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46268764	splice site	probably null
R5659:Dnah7b	UTSW	1	46352849	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46233992	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46277120	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46142132	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46191725	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46337593	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46221643	missense	probably benign
R5941:Dnah7b	UTSW	1	46187290	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46362987	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46119398	intron	probably null
R6041:Dnah7b	UTSW	1	46289645	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46139789	missense	probably benign
R6049:Dnah7b	UTSW	1	46085602	missense	probably benign
R6131:Dnah7b	UTSW	1	46253466	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46290703	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46233585	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46126668	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46225888	missense	probably benign
R6273:Dnah7b	UTSW	1	46242316	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46340175	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46242204	nonsense	probably null
R6494:Dnah7b	UTSW	1	46099431	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46224742	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46340217	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46191788	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46195120	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46119268	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46358238	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46195139	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46236809	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46352813	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46139710	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46126804	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46242142	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46139966	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46083754	missense	probably benign
R7244:Dnah7b	UTSW	1	46277143	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46142085	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46195372	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46303634	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46175419	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46290734	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46325765	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46356554	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46124346	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46214413	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46268634	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46109302	missense	probably benign
R7676:Dnah7b	UTSW	1	46234164	nonsense	probably null
R7731:Dnah7b	UTSW	1	46139745	missense	probably benign	0.00
R7768:Dnah7b	UTSW	1	46137474	missense	probably benign
R7807:Dnah7b	UTSW	1	46214367	missense	probably benign
R7895:Dnah7b	UTSW	1	46249950	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46139678	missense	probably damaging	1.00
R7978:Dnah7b	UTSW	1	46249950	missense	probably damaging	1.00
R7992:Dnah7b	UTSW	1	46139678	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46243365	missense	not run
R8069:Dnah7b	UTSW	1	46224706	nonsense	probably null
RF020:Dnah7b	UTSW	1	46373261	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46373298	nonsense	probably null
X0023:Dnah7b	UTSW	1	46303577	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCTGTGCAAAACTGATTCTGG -3'
(R):5'- GAGTCACAGCTCTCAGTTCTACC -3'

Sequencing Primer
(F):5'- GTGCAAAACTGATTCTGGACATTTAG -3'
(R):5'- CTTCAGATTGCCAGCAGCTGTG -3'

Posted On

2019-11-26