Mutagenetix > Incidental Mutation

Incidental Mutation 'R7760:Trmt1l'

597778

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7760 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 151442674 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 245 (T245I)

Ref Sequence

ENSEMBL: ENSMUSP00000068309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065625
AA Change: T245I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: T245I

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000189655
AA Change: T92I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286
AA Change: T92I

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anxa11	C	T	14: 25,872,827	Q162*	probably null	Het
Arg1	T	G	10: 24,927,463		probably benign	Het
Arl6	T	C	16: 59,618,806	D175G	probably damaging	Het
Capg	A	G	6: 72,557,786	R199G	probably damaging	Het
Ceacam1	T	A	7: 25,472,025	E338V	probably damaging	Het
Clec4d	A	G	6: 123,270,341	N148D	probably benign	Het
Ctr9	T	G	7: 111,046,601	I653R	probably damaging	Het
Dmwd	C	T	7: 19,080,735	L437F	probably damaging	Het
Dnah7b	T	A	1: 46,201,253	L1510Q	probably damaging	Het
Efcab5	T	A	11: 77,151,926	E136D	probably benign	Het
Elfn2	C	T	15: 78,673,841	A169T	probably benign	Het
Esrp2	T	A	8: 106,133,470	E326D	probably benign	Het
Fbrs	T	C	7: 127,489,400	V718A	probably damaging	Het
Fbxl21	T	C	13: 56,526,934	S33P	probably benign	Het
Fbxl21	C	T	13: 56,537,003	R307C	probably benign	Het
Gatad2b	C	T	3: 90,354,469	R461W	probably damaging	Het
Gm19410	T	A	8: 35,802,337	C1109S	probably damaging	Het
Gm6882	T	A	7: 21,427,484	D153V	probably damaging	Het
Gm7075	T	C	10: 63,421,537	K68R	probably damaging	Het
Golga3	A	G	5: 110,205,850	E918G	probably benign	Het
Greb1	T	C	12: 16,723,416	N219S	probably benign	Het
Grpel1	G	T	5: 36,470,642	R89L	probably damaging	Het
Ighv5-12	T	A	12: 113,702,175	Q101L	probably benign	Het
Ikbkap	A	G	4: 56,790,892	V287A	probably benign	Het
Ldb3	T	A	14: 34,542,503	N590I	probably damaging	Het
Man2c1	T	C	9: 57,139,363	V636A	probably benign	Het
Mblac2	G	T	13: 81,711,877	V117L	probably benign	Het
Muc6	T	A	7: 141,651,057		probably null	Het
Nfatc3	A	G	8: 106,108,341	E773G	possibly damaging	Het
Ngef	T	C	1: 87,540,773	D88G	probably benign	Het
Nipbl	T	C	15: 8,358,702	E478G	probably damaging	Het
Olfr720	T	C	14: 14,175,905	Y59C	probably damaging	Het
Pbx4	C	A	8: 69,832,795	D29E	probably benign	Het
Pcdhgb5	A	G	18: 37,731,637	I162V	not run	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pigr	A	T	1: 130,846,631	R449S	possibly damaging	Het
Plcb2	T	C	2: 118,711,388	T914A	probably benign	Het
Ppp5c	A	G	7: 17,006,349	S387P	probably damaging	Het
Rtkn2	T	G	10: 68,005,609	S196A	probably damaging	Het
Sec31a	A	G	5: 100,392,628	F400L	probably damaging	Het
Senp7	A	T	16: 56,139,079	M251L	probably benign	Het
Slc6a5	T	C	7: 49,946,617	F612L	probably benign	Het
Slc7a9	T	C	7: 35,457,075	I314T	possibly damaging	Het
Smc5	A	C	19: 23,235,890	S553A	probably benign	Het
Spaca3	T	A	11: 80,864,563	V133D	probably damaging	Het
Taco1	T	A	11: 106,073,112	D232E	possibly damaging	Het
Tarbp1	C	T	8: 126,452,807	R664H	not run	Het
Tlk2	T	C	11: 105,279,167	I674T	probably damaging	Het
Tnxb	A	T	17: 34,712,937	E2148V	probably damaging	Het
Tom1l2	T	C	11: 60,274,965	S59G	probably benign	Het
Traj46	A	T	14: 54,172,356	H7L		Het
Traj46	T	G	14: 54,172,357	H7Q		Het
Trav6-4	T	A	14: 53,454,646	L70Q	possibly damaging	Het
Wac	T	A	18: 7,921,913	C601S	probably benign	Het
Wnt3	T	A	11: 103,811,440	H145Q	probably benign	Het
Zfp948	T	C	17: 21,588,366	C607R	probably damaging	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2084:Trmt1l	UTSW	1	151440854	missense	probably damaging	1.00
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2338:Trmt1l	UTSW	1	151428959	intron	probably benign
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R3972:Trmt1l	UTSW	1	151433883	missense	possibly damaging	0.91
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4653:Trmt1l	UTSW	1	151439569	missense	probably benign	0.00
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6060:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7984:Trmt1l	UTSW	1	151435738	missense	probably benign	0.02
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R8514:Trmt1l	UTSW	1	151453991	missense	probably damaging	0.98
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AGAAACTGAGTGCATTTGTCCTG -3'
(R):5'- AAGTTGGGCCTATTTTAGTCTGAC -3'

Sequencing Primer
(F):5'- TGGCTTTGGCATAGCTACGAAAC -3'
(R):5'- TCACTCTGTAGACCAAGCTGG -3'

Posted On

2019-11-26