Incidental Mutation 'R7760:Plcb2'
ID597779
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7760 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118711388 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 914 (T914A)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect probably benign
Transcript: ENSMUST00000102524
AA Change: T937A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: T937A

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159756
AA Change: T914A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: T914A

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C T 14: 25,872,827 Q162* probably null Het
Arg1 T G 10: 24,927,463 probably benign Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Capg A G 6: 72,557,786 R199G probably damaging Het
Ceacam1 T A 7: 25,472,025 E338V probably damaging Het
Clec4d A G 6: 123,270,341 N148D probably benign Het
Ctr9 T G 7: 111,046,601 I653R probably damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dnah7b T A 1: 46,201,253 L1510Q probably damaging Het
Efcab5 T A 11: 77,151,926 E136D probably benign Het
Elfn2 C T 15: 78,673,841 A169T probably benign Het
Esrp2 T A 8: 106,133,470 E326D probably benign Het
Fbrs T C 7: 127,489,400 V718A probably damaging Het
Fbxl21 T C 13: 56,526,934 S33P probably benign Het
Fbxl21 C T 13: 56,537,003 R307C probably benign Het
Gatad2b C T 3: 90,354,469 R461W probably damaging Het
Gm19410 T A 8: 35,802,337 C1109S probably damaging Het
Gm6882 T A 7: 21,427,484 D153V probably damaging Het
Gm7075 T C 10: 63,421,537 K68R probably damaging Het
Golga3 A G 5: 110,205,850 E918G probably benign Het
Greb1 T C 12: 16,723,416 N219S probably benign Het
Grpel1 G T 5: 36,470,642 R89L probably damaging Het
Ighv5-12 T A 12: 113,702,175 Q101L probably benign Het
Ikbkap A G 4: 56,790,892 V287A probably benign Het
Ldb3 T A 14: 34,542,503 N590I probably damaging Het
Man2c1 T C 9: 57,139,363 V636A probably benign Het
Mblac2 G T 13: 81,711,877 V117L probably benign Het
Muc6 T A 7: 141,651,057 probably null Het
Nfatc3 A G 8: 106,108,341 E773G possibly damaging Het
Ngef T C 1: 87,540,773 D88G probably benign Het
Nipbl T C 15: 8,358,702 E478G probably damaging Het
Olfr720 T C 14: 14,175,905 Y59C probably damaging Het
Pbx4 C A 8: 69,832,795 D29E probably benign Het
Pcdhgb5 A G 18: 37,731,637 I162V not run Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pigr A T 1: 130,846,631 R449S possibly damaging Het
Ppp5c A G 7: 17,006,349 S387P probably damaging Het
Rtkn2 T G 10: 68,005,609 S196A probably damaging Het
Sec31a A G 5: 100,392,628 F400L probably damaging Het
Senp7 A T 16: 56,139,079 M251L probably benign Het
Slc6a5 T C 7: 49,946,617 F612L probably benign Het
Slc7a9 T C 7: 35,457,075 I314T possibly damaging Het
Smc5 A C 19: 23,235,890 S553A probably benign Het
Spaca3 T A 11: 80,864,563 V133D probably damaging Het
Taco1 T A 11: 106,073,112 D232E possibly damaging Het
Tarbp1 C T 8: 126,452,807 R664H not run Het
Tlk2 T C 11: 105,279,167 I674T probably damaging Het
Tnxb A T 17: 34,712,937 E2148V probably damaging Het
Tom1l2 T C 11: 60,274,965 S59G probably benign Het
Traj46 A T 14: 54,172,356 H7L Het
Traj46 T G 14: 54,172,357 H7Q Het
Trav6-4 T A 14: 53,454,646 L70Q possibly damaging Het
Trmt1l C T 1: 151,442,674 T245I possibly damaging Het
Wac T A 18: 7,921,913 C601S probably benign Het
Wnt3 T A 11: 103,811,440 H145Q probably benign Het
Zfp948 T C 17: 21,588,366 C607R probably damaging Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
PIT4480001:Plcb2 UTSW 2 118723496 missense probably benign 0.00
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0157:Plcb2 UTSW 2 118718541 missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0790:Plcb2 UTSW 2 118712483 splice site probably benign
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1647:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2426:Plcb2 UTSW 2 118715649 missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118709587 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118712003 missense probably benign 0.28
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118710234 missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118715643 missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118719759 missense possibly damaging 0.86
R8152:Plcb2 UTSW 2 118710821 missense probably benign 0.22
R8170:Plcb2 UTSW 2 118711453 missense possibly damaging 0.68
R8413:Plcb2 UTSW 2 118718823 missense probably damaging 1.00
R8913:Plcb2 UTSW 2 118713884 missense probably damaging 1.00
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Z1176:Plcb2 UTSW 2 118723128 missense probably damaging 0.99
Z1177:Plcb2 UTSW 2 118709200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGGCGATTTGCTGCGAAG -3'
(R):5'- CTCAAGCCATGCCTCTACAGAG -3'

Sequencing Primer
(F):5'- CCTTGGCTGTGCAGAAAGG -3'
(R):5'- TGCCTCTACAGAGCCACAG -3'
Posted On2019-11-26