Incidental Mutation 'R7760:Golga3'
ID597785
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7760 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110205850 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 918 (E918G)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031477
AA Change: E958G

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: E958G

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: E918G

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: E918G

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C T 14: 25,872,827 Q162* probably null Het
Arg1 T G 10: 24,927,463 probably benign Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Capg A G 6: 72,557,786 R199G probably damaging Het
Ceacam1 T A 7: 25,472,025 E338V probably damaging Het
Clec4d A G 6: 123,270,341 N148D probably benign Het
Ctr9 T G 7: 111,046,601 I653R probably damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dnah7b T A 1: 46,201,253 L1510Q probably damaging Het
Efcab5 T A 11: 77,151,926 E136D probably benign Het
Elfn2 C T 15: 78,673,841 A169T probably benign Het
Esrp2 T A 8: 106,133,470 E326D probably benign Het
Fbrs T C 7: 127,489,400 V718A probably damaging Het
Fbxl21 T C 13: 56,526,934 S33P probably benign Het
Fbxl21 C T 13: 56,537,003 R307C probably benign Het
Gatad2b C T 3: 90,354,469 R461W probably damaging Het
Gm19410 T A 8: 35,802,337 C1109S probably damaging Het
Gm6882 T A 7: 21,427,484 D153V probably damaging Het
Gm7075 T C 10: 63,421,537 K68R probably damaging Het
Greb1 T C 12: 16,723,416 N219S probably benign Het
Grpel1 G T 5: 36,470,642 R89L probably damaging Het
Ighv5-12 T A 12: 113,702,175 Q101L probably benign Het
Ikbkap A G 4: 56,790,892 V287A probably benign Het
Ldb3 T A 14: 34,542,503 N590I probably damaging Het
Man2c1 T C 9: 57,139,363 V636A probably benign Het
Mblac2 G T 13: 81,711,877 V117L probably benign Het
Muc6 T A 7: 141,651,057 probably null Het
Nfatc3 A G 8: 106,108,341 E773G possibly damaging Het
Ngef T C 1: 87,540,773 D88G probably benign Het
Nipbl T C 15: 8,358,702 E478G probably damaging Het
Olfr720 T C 14: 14,175,905 Y59C probably damaging Het
Pbx4 C A 8: 69,832,795 D29E probably benign Het
Pcdhgb5 A G 18: 37,731,637 I162V not run Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pigr A T 1: 130,846,631 R449S possibly damaging Het
Plcb2 T C 2: 118,711,388 T914A probably benign Het
Ppp5c A G 7: 17,006,349 S387P probably damaging Het
Rtkn2 T G 10: 68,005,609 S196A probably damaging Het
Sec31a A G 5: 100,392,628 F400L probably damaging Het
Senp7 A T 16: 56,139,079 M251L probably benign Het
Slc6a5 T C 7: 49,946,617 F612L probably benign Het
Slc7a9 T C 7: 35,457,075 I314T possibly damaging Het
Smc5 A C 19: 23,235,890 S553A probably benign Het
Spaca3 T A 11: 80,864,563 V133D probably damaging Het
Taco1 T A 11: 106,073,112 D232E possibly damaging Het
Tarbp1 C T 8: 126,452,807 R664H not run Het
Tlk2 T C 11: 105,279,167 I674T probably damaging Het
Tnxb A T 17: 34,712,937 E2148V probably damaging Het
Tom1l2 T C 11: 60,274,965 S59G probably benign Het
Traj46 A T 14: 54,172,356 H7L Het
Traj46 T G 14: 54,172,357 H7Q Het
Trav6-4 T A 14: 53,454,646 L70Q possibly damaging Het
Trmt1l C T 1: 151,442,674 T245I possibly damaging Het
Wac T A 18: 7,921,913 C601S probably benign Het
Wnt3 T A 11: 103,811,440 H145Q probably benign Het
Zfp948 T C 17: 21,588,366 C607R probably damaging Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCGATCGCTAGGAAGTGTTG -3'
(R):5'- GCTTCTGTAAAGGATGCTTGAG -3'

Sequencing Primer
(F):5'- ATCGCTAGGAAGTGTTGTCATCAG -3'
(R):5'- GGTAACTGCCAAATCATGACG -3'
Posted On2019-11-26