Incidental Mutation 'R7760:Ppp5c'
ID597788
Institutional Source Beutler Lab
Gene Symbol Ppp5c
Ensembl Gene ENSMUSG00000003099
Gene Nameprotein phosphatase 5, catalytic subunit
SynonymsANP receptor, PP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7760 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17004640-17027924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17006349 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 387 (S387P)
Ref Sequence ENSEMBL: ENSMUSP00000003183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003183]
Predicted Effect probably damaging
Transcript: ENSMUST00000003183
AA Change: S387P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003183
Gene: ENSMUSG00000003099
AA Change: S387P

DomainStartEndE-ValueType
TPR 28 61 1.92e-6 SMART
TPR 62 95 8.29e0 SMART
TPR 96 129 4.28e-4 SMART
PP2Ac 204 480 2.8e-164 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122783
Gene: ENSMUSG00000003099
AA Change: S363P

DomainStartEndE-ValueType
TPR 27 60 1.92e-6 SMART
TPR 61 94 8.29e0 SMART
TPR 95 128 4.28e-4 SMART
PP2Ac 203 457 1.83e-145 SMART
Meta Mutation Damage Score 0.8702 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in cell cycle check-point arrest following treatment with ionizing radition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C T 14: 25,872,827 Q162* probably null Het
Arg1 T G 10: 24,927,463 probably benign Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Capg A G 6: 72,557,786 R199G probably damaging Het
Ceacam1 T A 7: 25,472,025 E338V probably damaging Het
Clec4d A G 6: 123,270,341 N148D probably benign Het
Ctr9 T G 7: 111,046,601 I653R probably damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dnah7b T A 1: 46,201,253 L1510Q probably damaging Het
Efcab5 T A 11: 77,151,926 E136D probably benign Het
Elfn2 C T 15: 78,673,841 A169T probably benign Het
Esrp2 T A 8: 106,133,470 E326D probably benign Het
Fbrs T C 7: 127,489,400 V718A probably damaging Het
Fbxl21 T C 13: 56,526,934 S33P probably benign Het
Fbxl21 C T 13: 56,537,003 R307C probably benign Het
Gatad2b C T 3: 90,354,469 R461W probably damaging Het
Gm19410 T A 8: 35,802,337 C1109S probably damaging Het
Gm6882 T A 7: 21,427,484 D153V probably damaging Het
Gm7075 T C 10: 63,421,537 K68R probably damaging Het
Golga3 A G 5: 110,205,850 E918G probably benign Het
Greb1 T C 12: 16,723,416 N219S probably benign Het
Grpel1 G T 5: 36,470,642 R89L probably damaging Het
Ighv5-12 T A 12: 113,702,175 Q101L probably benign Het
Ikbkap A G 4: 56,790,892 V287A probably benign Het
Ldb3 T A 14: 34,542,503 N590I probably damaging Het
Man2c1 T C 9: 57,139,363 V636A probably benign Het
Mblac2 G T 13: 81,711,877 V117L probably benign Het
Muc6 T A 7: 141,651,057 probably null Het
Nfatc3 A G 8: 106,108,341 E773G possibly damaging Het
Ngef T C 1: 87,540,773 D88G probably benign Het
Nipbl T C 15: 8,358,702 E478G probably damaging Het
Olfr720 T C 14: 14,175,905 Y59C probably damaging Het
Pbx4 C A 8: 69,832,795 D29E probably benign Het
Pcdhgb5 A G 18: 37,731,637 I162V not run Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pigr A T 1: 130,846,631 R449S possibly damaging Het
Plcb2 T C 2: 118,711,388 T914A probably benign Het
Rtkn2 T G 10: 68,005,609 S196A probably damaging Het
Sec31a A G 5: 100,392,628 F400L probably damaging Het
Senp7 A T 16: 56,139,079 M251L probably benign Het
Slc6a5 T C 7: 49,946,617 F612L probably benign Het
Slc7a9 T C 7: 35,457,075 I314T possibly damaging Het
Smc5 A C 19: 23,235,890 S553A probably benign Het
Spaca3 T A 11: 80,864,563 V133D probably damaging Het
Taco1 T A 11: 106,073,112 D232E possibly damaging Het
Tarbp1 C T 8: 126,452,807 R664H not run Het
Tlk2 T C 11: 105,279,167 I674T probably damaging Het
Tnxb A T 17: 34,712,937 E2148V probably damaging Het
Tom1l2 T C 11: 60,274,965 S59G probably benign Het
Traj46 A T 14: 54,172,356 H7L Het
Traj46 T G 14: 54,172,357 H7Q Het
Trav6-4 T A 14: 53,454,646 L70Q possibly damaging Het
Trmt1l C T 1: 151,442,674 T245I possibly damaging Het
Wac T A 18: 7,921,913 C601S probably benign Het
Wnt3 T A 11: 103,811,440 H145Q probably benign Het
Zfp948 T C 17: 21,588,366 C607R probably damaging Het
Other mutations in Ppp5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Ppp5c APN 7 17008630 missense possibly damaging 0.87
IGL02794:Ppp5c APN 7 17006960 missense probably benign 0.15
IGL02831:Ppp5c APN 7 17008645 missense probably damaging 1.00
IGL02950:Ppp5c APN 7 17006910 missense probably benign 0.00
Persephone UTSW 7 17022443 missense probably benign 0.01
R0078:Ppp5c UTSW 7 17027725 missense probably benign 0.09
R0366:Ppp5c UTSW 7 17022583 nonsense probably null
R1102:Ppp5c UTSW 7 17022443 missense probably benign 0.01
R1511:Ppp5c UTSW 7 17009982 missense probably damaging 1.00
R1518:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R1714:Ppp5c UTSW 7 17008703 missense probably benign 0.01
R1754:Ppp5c UTSW 7 17005310 missense probably benign 0.20
R2380:Ppp5c UTSW 7 17006115 missense probably damaging 1.00
R2431:Ppp5c UTSW 7 17015425 missense probably damaging 0.99
R4854:Ppp5c UTSW 7 17009022 missense probably benign 0.00
R4974:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R5303:Ppp5c UTSW 7 17005284 missense probably benign
R5626:Ppp5c UTSW 7 17027704 missense probably benign
R5785:Ppp5c UTSW 7 17027691 critical splice donor site probably null
R6059:Ppp5c UTSW 7 17027907 unclassified probably benign
R6855:Ppp5c UTSW 7 17006966 missense possibly damaging 0.95
R7885:Ppp5c UTSW 7 17006186 missense possibly damaging 0.86
R7922:Ppp5c UTSW 7 17027800 missense possibly damaging 0.72
R8113:Ppp5c UTSW 7 17009007 missense probably benign
R8170:Ppp5c UTSW 7 17007146 missense probably damaging 0.99
X0026:Ppp5c UTSW 7 17007110 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCTGCGGATGATATAGTCCAG -3'
(R):5'- AAAGTTCCATCCAGCAGCAG -3'

Sequencing Primer
(F):5'- CAGTTGATTCTCCTCCAGGAAGG -3'
(R):5'- CAGCAGGCTTATAATGGATAGACTG -3'
Posted On2019-11-26