Incidental Mutation 'R7760:Elfn2'
ID597823
Institutional Source Beutler Lab
Gene Symbol Elfn2
Ensembl Gene ENSMUSG00000043460
Gene Nameleucine rich repeat and fibronectin type III, extracellular 2
SynonymsLrrc62
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7760 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78667331-78718771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78673841 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 169 (A169T)
Ref Sequence ENSEMBL: ENSMUSP00000085960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088592] [ENSMUST00000229441]
Predicted Effect probably benign
Transcript: ENSMUST00000088592
AA Change: A169T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085960
Gene: ENSMUSG00000043460
AA Change: A169T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRR 78 101 9.96e-1 SMART
LRR 103 125 5.56e0 SMART
LRR 126 149 6.96e0 SMART
LRR 150 173 1.66e1 SMART
LRRCT 185 240 9.74e-2 SMART
FN3 293 371 4.56e0 SMART
transmembrane domain 397 419 N/A INTRINSIC
low complexity region 583 598 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
low complexity region 686 696 N/A INTRINSIC
low complexity region 754 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229441
AA Change: A169T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C T 14: 25,872,827 Q162* probably null Het
Arg1 T G 10: 24,927,463 probably benign Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Capg A G 6: 72,557,786 R199G probably damaging Het
Ceacam1 T A 7: 25,472,025 E338V probably damaging Het
Clec4d A G 6: 123,270,341 N148D probably benign Het
Ctr9 T G 7: 111,046,601 I653R probably damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dnah7b T A 1: 46,201,253 L1510Q probably damaging Het
Efcab5 T A 11: 77,151,926 E136D probably benign Het
Esrp2 T A 8: 106,133,470 E326D probably benign Het
Fbrs T C 7: 127,489,400 V718A probably damaging Het
Fbxl21 T C 13: 56,526,934 S33P probably benign Het
Fbxl21 C T 13: 56,537,003 R307C probably benign Het
Gatad2b C T 3: 90,354,469 R461W probably damaging Het
Gm19410 T A 8: 35,802,337 C1109S probably damaging Het
Gm6882 T A 7: 21,427,484 D153V probably damaging Het
Gm7075 T C 10: 63,421,537 K68R probably damaging Het
Golga3 A G 5: 110,205,850 E918G probably benign Het
Greb1 T C 12: 16,723,416 N219S probably benign Het
Grpel1 G T 5: 36,470,642 R89L probably damaging Het
Ighv5-12 T A 12: 113,702,175 Q101L probably benign Het
Ikbkap A G 4: 56,790,892 V287A probably benign Het
Ldb3 T A 14: 34,542,503 N590I probably damaging Het
Man2c1 T C 9: 57,139,363 V636A probably benign Het
Mblac2 G T 13: 81,711,877 V117L probably benign Het
Muc6 T A 7: 141,651,057 probably null Het
Nfatc3 A G 8: 106,108,341 E773G possibly damaging Het
Ngef T C 1: 87,540,773 D88G probably benign Het
Nipbl T C 15: 8,358,702 E478G probably damaging Het
Olfr720 T C 14: 14,175,905 Y59C probably damaging Het
Pbx4 C A 8: 69,832,795 D29E probably benign Het
Pcdhgb5 A G 18: 37,731,637 I162V not run Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pigr A T 1: 130,846,631 R449S possibly damaging Het
Plcb2 T C 2: 118,711,388 T914A probably benign Het
Ppp5c A G 7: 17,006,349 S387P probably damaging Het
Rtkn2 T G 10: 68,005,609 S196A probably damaging Het
Sec31a A G 5: 100,392,628 F400L probably damaging Het
Senp7 A T 16: 56,139,079 M251L probably benign Het
Slc6a5 T C 7: 49,946,617 F612L probably benign Het
Slc7a9 T C 7: 35,457,075 I314T possibly damaging Het
Smc5 A C 19: 23,235,890 S553A probably benign Het
Spaca3 T A 11: 80,864,563 V133D probably damaging Het
Taco1 T A 11: 106,073,112 D232E possibly damaging Het
Tarbp1 C T 8: 126,452,807 R664H not run Het
Tlk2 T C 11: 105,279,167 I674T probably damaging Het
Tnxb A T 17: 34,712,937 E2148V probably damaging Het
Tom1l2 T C 11: 60,274,965 S59G probably benign Het
Traj46 A T 14: 54,172,356 H7L Het
Traj46 T G 14: 54,172,357 H7Q Het
Trav6-4 T A 14: 53,454,646 L70Q possibly damaging Het
Trmt1l C T 1: 151,442,674 T245I possibly damaging Het
Wac T A 18: 7,921,913 C601S probably benign Het
Wnt3 T A 11: 103,811,440 H145Q probably benign Het
Zfp948 T C 17: 21,588,366 C607R probably damaging Het
Other mutations in Elfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Elfn2 APN 15 78672418 missense possibly damaging 0.88
IGL02165:Elfn2 APN 15 78673418 missense probably benign 0.04
IGL02951:Elfn2 APN 15 78671882 missense probably damaging 1.00
IGL03402:Elfn2 APN 15 78673470 missense possibly damaging 0.50
R0083:Elfn2 UTSW 15 78673414 missense probably damaging 1.00
R0441:Elfn2 UTSW 15 78673595 missense probably benign 0.09
R0570:Elfn2 UTSW 15 78673234 missense probably damaging 1.00
R1155:Elfn2 UTSW 15 78673144 missense probably benign 0.03
R1670:Elfn2 UTSW 15 78672368 missense probably benign 0.05
R2033:Elfn2 UTSW 15 78671896 missense probably damaging 1.00
R2138:Elfn2 UTSW 15 78674038 missense probably benign 0.05
R2167:Elfn2 UTSW 15 78672446 missense probably benign 0.09
R2226:Elfn2 UTSW 15 78674243 missense probably damaging 1.00
R2497:Elfn2 UTSW 15 78674264 missense probably damaging 1.00
R5175:Elfn2 UTSW 15 78673873 missense probably damaging 1.00
R5215:Elfn2 UTSW 15 78674201 missense probably damaging 1.00
R5588:Elfn2 UTSW 15 78673876 missense probably damaging 1.00
R7291:Elfn2 UTSW 15 78672983 missense probably benign 0.21
R7893:Elfn2 UTSW 15 78673168 missense probably damaging 1.00
R8018:Elfn2 UTSW 15 78673768 missense probably damaging 1.00
R8084:Elfn2 UTSW 15 78672460 missense probably damaging 0.98
R8112:Elfn2 UTSW 15 78673435 missense probably damaging 0.97
R8501:Elfn2 UTSW 15 78674300 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAGTGATGGCATTGAGGCTG -3'
(R):5'- ACATCGAGGATGGTGCCTTC -3'

Sequencing Primer
(F):5'- TAAGGTCTGGGCACGAGC -3'
(R):5'- TGCAGCTGGGCTACAAC -3'
Posted On2019-11-26