Incidental Mutation 'R7760:Smc5'
ID597830
Institutional Source Beutler Lab
Gene Symbol Smc5
Ensembl Gene ENSMUSG00000024943
Gene Namestructural maintenance of chromosomes 5
SynonymsSmc5l1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7760 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location23206451-23273897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23235890 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 553 (S553A)
Ref Sequence ENSEMBL: ENSMUSP00000084837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087556] [ENSMUST00000223934] [ENSMUST00000226111]
Predicted Effect probably benign
Transcript: ENSMUST00000087556
AA Change: S553A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943
AA Change: S553A

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223934
AA Change: S553A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000226111
AA Change: S477A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout in embryonic stem cells causes abnormal mitosis, increased apoptosis and a shift from pluripotency to differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C T 14: 25,872,827 Q162* probably null Het
Arg1 T G 10: 24,927,463 probably benign Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Capg A G 6: 72,557,786 R199G probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam1 T A 7: 25,472,025 E338V probably damaging Het
Clec4d A G 6: 123,270,341 N148D probably benign Het
Ctr9 T G 7: 111,046,601 I653R probably damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dnah7b T A 1: 46,201,253 L1510Q probably damaging Het
Efcab5 T A 11: 77,151,926 E136D probably benign Het
Elfn2 C T 15: 78,673,841 A169T probably benign Het
Esrp2 T A 8: 106,133,470 E326D probably benign Het
Fbrs T C 7: 127,489,400 V718A probably damaging Het
Fbxl21 T C 13: 56,526,934 S33P probably benign Het
Fbxl21 C T 13: 56,537,003 R307C probably benign Het
Gatad2b C T 3: 90,354,469 R461W probably damaging Het
Gm19410 T A 8: 35,802,337 C1109S probably damaging Het
Gm6882 T A 7: 21,427,484 D153V probably damaging Het
Gm7075 T C 10: 63,421,537 K68R probably damaging Het
Golga3 A G 5: 110,205,850 E918G probably benign Het
Greb1 T C 12: 16,723,416 N219S probably benign Het
Grpel1 G T 5: 36,470,642 R89L probably damaging Het
Ighv5-12 T A 12: 113,702,175 Q101L probably benign Het
Ikbkap A G 4: 56,790,892 V287A probably benign Het
Ldb3 T A 14: 34,542,503 N590I probably damaging Het
Man2c1 T C 9: 57,139,363 V636A probably benign Het
Mblac2 G T 13: 81,711,877 V117L probably benign Het
Nfatc3 A G 8: 106,108,341 E773G possibly damaging Het
Ngef T C 1: 87,540,773 D88G probably benign Het
Nipbl T C 15: 8,358,702 E478G probably damaging Het
Olfr720 T C 14: 14,175,905 Y59C probably damaging Het
Pbx4 C A 8: 69,832,795 D29E probably benign Het
Pcdhgb5 A G 18: 37,731,637 I162V not run Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pigr A T 1: 130,846,631 R449S possibly damaging Het
Plcb2 T C 2: 118,711,388 T914A probably benign Het
Ppp5c A G 7: 17,006,349 S387P probably damaging Het
Rtkn2 T G 10: 68,005,609 S196A probably damaging Het
Sec31a A G 5: 100,392,628 F400L probably damaging Het
Senp7 A T 16: 56,139,079 M251L probably benign Het
Slc6a5 T C 7: 49,946,617 F612L probably benign Het
Slc7a9 T C 7: 35,457,075 I314T possibly damaging Het
Spaca3 T A 11: 80,864,563 V133D probably damaging Het
Taco1 T A 11: 106,073,112 D232E possibly damaging Het
Tarbp1 C T 8: 126,452,807 R664H not run Het
Tlk2 T C 11: 105,279,167 I674T probably damaging Het
Tnxb A T 17: 34,712,937 E2148V probably damaging Het
Tom1l2 T C 11: 60,274,965 S59G probably benign Het
Traj46 A T 14: 54,172,356 H7L Het
Traj46 T G 14: 54,172,357 H7Q Het
Trav6-4 T A 14: 53,454,646 L70Q possibly damaging Het
Trmt1l C T 1: 151,442,674 T245I possibly damaging Het
Wac T A 18: 7,921,913 C601S probably benign Het
Wnt3 T A 11: 103,811,440 H145Q probably benign Het
Zfp948 T C 17: 21,588,366 C607R probably damaging Het
Other mutations in Smc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Smc5 APN 19 23235965 missense probably damaging 1.00
IGL01070:Smc5 APN 19 23231601 missense possibly damaging 0.86
IGL01315:Smc5 APN 19 23231604 missense probably benign
IGL01879:Smc5 APN 19 23228184 missense probably damaging 0.97
IGL01902:Smc5 APN 19 23259768 missense possibly damaging 0.85
IGL02016:Smc5 APN 19 23273712 missense probably benign 0.00
IGL02186:Smc5 APN 19 23231859 missense probably damaging 1.00
IGL02383:Smc5 APN 19 23214632 splice site probably benign
IGL02447:Smc5 APN 19 23257492 missense probably benign 0.01
IGL02534:Smc5 APN 19 23228172 critical splice donor site probably null
IGL02834:Smc5 APN 19 23257604 missense probably benign 0.30
IGL03290:Smc5 APN 19 23273658 missense probably benign 0.19
R0722:Smc5 UTSW 19 23208927 missense probably damaging 0.99
R0893:Smc5 UTSW 19 23263653 missense possibly damaging 0.67
R0970:Smc5 UTSW 19 23238998 missense probably damaging 1.00
R1281:Smc5 UTSW 19 23235883 missense probably benign
R1368:Smc5 UTSW 19 23210443 missense probably damaging 1.00
R2092:Smc5 UTSW 19 23238899 missense probably benign
R3721:Smc5 UTSW 19 23210492 missense probably benign 0.21
R4382:Smc5 UTSW 19 23268846 missense probably benign 0.39
R4735:Smc5 UTSW 19 23242705 missense probably benign
R4936:Smc5 UTSW 19 23234003 missense probably damaging 1.00
R5306:Smc5 UTSW 19 23259645 critical splice donor site probably null
R5754:Smc5 UTSW 19 23244103 missense possibly damaging 0.92
R6175:Smc5 UTSW 19 23214170 missense possibly damaging 0.60
R6313:Smc5 UTSW 19 23208948 nonsense probably null
R6527:Smc5 UTSW 19 23228190 missense probably benign 0.00
R6611:Smc5 UTSW 19 23228919 missense probably benign 0.13
R6750:Smc5 UTSW 19 23242640 missense probably damaging 1.00
R6801:Smc5 UTSW 19 23214646 missense probably benign 0.34
R6821:Smc5 UTSW 19 23242787 missense probably benign 0.20
R7002:Smc5 UTSW 19 23231883 missense probably benign 0.00
R7198:Smc5 UTSW 19 23259700 nonsense probably null
R7386:Smc5 UTSW 19 23215175 missense possibly damaging 0.59
R7439:Smc5 UTSW 19 23242700 missense probably damaging 0.97
R7596:Smc5 UTSW 19 23214169 missense probably damaging 0.99
R7666:Smc5 UTSW 19 23229017 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCTACATGACACATTCCTAAGC -3'
(R):5'- TGAAAGCATAGCACTGCCATC -3'

Sequencing Primer
(F):5'- AGCTTCAACTTTTCCAGTTTTAGAC -3'
(R):5'- GTAATTCCAGCCTGTGACAGACTG -3'
Posted On2019-11-26