Incidental Mutation 'R7761:Scn3a'
ID597838
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7761 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65529454 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 137 (T137S)
Ref Sequence ENSEMBL: ENSMUSP00000065023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066432
AA Change: T137S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: T137S

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100069
AA Change: T137S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: T137S

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126837
SMART Domains Protein: ENSMUSP00000115321
Gene: ENSMUSG00000057182

DomainStartEndE-ValueType
Pfam:Ion_trans 1 122 6.1e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,330,288 C378Y probably damaging Het
Adcy6 A C 15: 98,600,014 L421R probably damaging Het
AI837181 A G 19: 5,426,291 T161A probably benign Het
Ascl2 A G 7: 142,968,103 S203P possibly damaging Het
Casq2 G T 3: 102,145,264 W364L probably damaging Het
Cdc20 T C 4: 118,435,989 T245A possibly damaging Het
Cfap99 C T 5: 34,323,430 Q475* probably null Het
Chmp2b G A 16: 65,546,859 T104I possibly damaging Het
Cln3 A T 7: 126,581,714 Y52N probably damaging Het
Cpm A G 10: 117,683,435 Y416C possibly damaging Het
Creb3l3 T C 10: 81,084,999 D399G possibly damaging Het
Dbnl A G 11: 5,788,597 Q13R probably benign Het
Dnah11 T A 12: 118,023,913 Q2418L probably damaging Het
Echs1 A T 7: 140,112,465 I123N probably damaging Het
Exd2 T C 12: 80,475,772 S2P probably damaging Het
F2rl1 A G 13: 95,513,874 F167L probably damaging Het
Fam83g C A 11: 61,684,758 D75E possibly damaging Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Gm10031 A T 1: 156,525,137 K303* probably null Het
Gm10283 A T 8: 60,501,202 probably null Het
Gm14409 T C 2: 177,265,517 I63V possibly damaging Het
Gm14410 T C 2: 177,193,734 N246D probably benign Het
Gpr39 A T 1: 125,677,512 Q59L probably damaging Het
Hic1 C T 11: 75,167,374 A230T probably damaging Het
Hmcn1 A G 1: 150,722,445 L1702P possibly damaging Het
Kif13a A T 13: 46,798,479 Y773N probably benign Het
Lins1 A T 7: 66,714,105 R583* probably null Het
Lrch4 T A 5: 137,639,763 H102Q Het
Ltn1 T C 16: 87,411,793 T806A probably benign Het
Luc7l2 G A 6: 38,555,064 probably null Het
Mdfic T C 6: 15,728,056 I25T unknown Het
Muc16 G T 9: 18,580,574 T6727N probably damaging Het
Nalcn C A 14: 123,294,379 G1353V probably damaging Het
Nalcn C G 14: 123,294,380 G1353R probably damaging Het
Nbeal1 C T 1: 60,319,341 P2476S probably benign Het
Nell2 T C 15: 95,432,669 T233A probably damaging Het
Nobox G A 6: 43,304,191 Q450* probably null Het
Nostrin T G 2: 69,161,122 L153R possibly damaging Het
Nup160 T C 2: 90,703,112 V635A probably benign Het
Odf3l1 A G 9: 56,852,538 L16P unknown Het
Olfr1276 T C 2: 111,257,174 S20P possibly damaging Het
Olfr1283 C T 2: 111,368,793 H54Y probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Olfr682-ps1 A G 7: 105,126,719 I184T probably benign Het
Opn4 T A 14: 34,598,852 M84L probably benign Het
Papolg T C 11: 23,891,884 Q13R probably benign Het
Pax6 T G 2: 105,691,691 F231C probably damaging Het
Pcdha3 T C 18: 36,946,294 Y30H probably damaging Het
Pkhd1l1 A G 15: 44,529,884 T1872A probably benign Het
Pln T C 10: 53,343,909 S16P probably damaging Het
Ppp4r3a C T 12: 101,055,821 E308K probably damaging Het
Prp2 C T 6: 132,600,343 Q198* probably null Het
Ptpn20 T A 14: 33,622,552 S144R probably benign Het
Pum3 A T 19: 27,427,092 F10L probably benign Het
Rapgefl1 A T 11: 98,837,659 D169V probably benign Het
Rbm12b1 T C 4: 12,146,460 Y811H possibly damaging Het
Rcor1 T A 12: 111,109,863 F418L Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd11 T C 4: 156,247,825 T520A probably benign Het
Sgo2b T C 8: 63,926,912 N962S probably benign Het
Slc39a12 T A 2: 14,434,330 I465N probably benign Het
Spcs1 T A 14: 31,001,650 probably benign Het
Stard9 T C 2: 120,699,379 V2039A probably benign Het
Syt11 G T 3: 88,762,471 T38K possibly damaging Het
Tcf7l2 T A 19: 55,926,036 C454S probably damaging Het
Tfap2a G C 13: 40,725,180 H155D probably benign Het
Trim46 T C 3: 89,242,258 K273R probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Ttc39d G A 17: 80,217,312 A467T probably damaging Het
Ttn T C 2: 76,719,930 T31636A probably benign Het
U2surp A G 9: 95,488,761 V420A probably damaging Het
Vps26b T C 9: 27,029,530 D31G probably benign Het
Vps35 T C 8: 85,284,078 E212G possibly damaging Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAATCTCTGAAAGTGCTG -3'
(R):5'- CCTTAAGGGAGGCTTTGAATTTTC -3'

Sequencing Primer
(F):5'- TTCATGCCATTCTCAGAACTACAG -3'
(R):5'- CTTATTAACCATGGTCTGAACCCAG -3'
Posted On2019-11-26