Incidental Mutation 'R7761:Nostrin'
ID597839
Institutional Source Beutler Lab
Gene Symbol Nostrin
Ensembl Gene ENSMUSG00000034738
Gene Namenitric oxide synthase trafficker
SynonymsmDaIP2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R7761 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69135800-69189330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 69161122 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 153 (L153R)
Ref Sequence ENSEMBL: ENSMUSP00000036923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041865]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041865
AA Change: L153R

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: L153R

DomainStartEndE-ValueType
Pfam:FCH 13 88 4.9e-12 PFAM
low complexity region 135 146 N/A INTRINSIC
coiled coil region 160 190 N/A INTRINSIC
coiled coil region 305 334 N/A INTRINSIC
low complexity region 419 439 N/A INTRINSIC
SH3 441 496 8.89e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,330,288 C378Y probably damaging Het
Adcy6 A C 15: 98,600,014 L421R probably damaging Het
AI837181 A G 19: 5,426,291 T161A probably benign Het
Ascl2 A G 7: 142,968,103 S203P possibly damaging Het
Casq2 G T 3: 102,145,264 W364L probably damaging Het
Cdc20 T C 4: 118,435,989 T245A possibly damaging Het
Cfap99 C T 5: 34,323,430 Q475* probably null Het
Chmp2b G A 16: 65,546,859 T104I possibly damaging Het
Cln3 A T 7: 126,581,714 Y52N probably damaging Het
Cpm A G 10: 117,683,435 Y416C possibly damaging Het
Creb3l3 T C 10: 81,084,999 D399G possibly damaging Het
Dbnl A G 11: 5,788,597 Q13R probably benign Het
Dnah11 T A 12: 118,023,913 Q2418L probably damaging Het
Echs1 A T 7: 140,112,465 I123N probably damaging Het
Exd2 T C 12: 80,475,772 S2P probably damaging Het
F2rl1 A G 13: 95,513,874 F167L probably damaging Het
Fam83g C A 11: 61,684,758 D75E possibly damaging Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Ggnbp2 A T 11: 84,839,977 probably null Het
Gm10031 A T 1: 156,525,137 K303* probably null Het
Gm10283 A T 8: 60,501,202 probably null Het
Gm14409 T C 2: 177,265,517 I63V possibly damaging Het
Gm14410 T C 2: 177,193,734 N246D probably benign Het
Gpr39 A T 1: 125,677,512 Q59L probably damaging Het
Hic1 C T 11: 75,167,374 A230T probably damaging Het
Hmcn1 A G 1: 150,722,445 L1702P possibly damaging Het
Kif13a A T 13: 46,798,479 Y773N probably benign Het
Lins1 A T 7: 66,714,105 R583* probably null Het
Lrch4 T A 5: 137,639,763 H102Q Het
Ltn1 T C 16: 87,411,793 T806A probably benign Het
Luc7l2 G A 6: 38,555,064 probably null Het
Mdfic T C 6: 15,728,056 I25T unknown Het
Muc16 G T 9: 18,580,574 T6727N probably damaging Het
Nalcn C A 14: 123,294,379 G1353V probably damaging Het
Nalcn C G 14: 123,294,380 G1353R probably damaging Het
Nbeal1 C T 1: 60,319,341 P2476S probably benign Het
Nell2 T C 15: 95,432,669 T233A probably damaging Het
Nobox G A 6: 43,304,191 Q450* probably null Het
Nup160 T C 2: 90,703,112 V635A probably benign Het
Odf3l1 A G 9: 56,852,538 L16P unknown Het
Olfr1276 T C 2: 111,257,174 S20P possibly damaging Het
Olfr1283 C T 2: 111,368,793 H54Y probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Olfr682-ps1 A G 7: 105,126,719 I184T probably benign Het
Opn4 T A 14: 34,598,852 M84L probably benign Het
Papolg T C 11: 23,891,884 Q13R probably benign Het
Pax6 T G 2: 105,691,691 F231C probably damaging Het
Pcdha3 T C 18: 36,946,294 Y30H probably damaging Het
Pkhd1l1 A G 15: 44,529,884 T1872A probably benign Het
Pln T C 10: 53,343,909 S16P probably damaging Het
Ppp4r3a C T 12: 101,055,821 E308K probably damaging Het
Prp2 C T 6: 132,600,343 Q198* probably null Het
Ptpn20 T A 14: 33,622,552 S144R probably benign Het
Pum3 A T 19: 27,427,092 F10L probably benign Het
Rapgefl1 A T 11: 98,837,659 D169V probably benign Het
Rbm12b1 T C 4: 12,146,460 Y811H possibly damaging Het
Rcor1 T A 12: 111,109,863 F418L Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd11 T C 4: 156,247,825 T520A probably benign Het
Scn3a T A 2: 65,529,454 T137S possibly damaging Het
Sgo2b T C 8: 63,926,912 N962S probably benign Het
Slc39a12 T A 2: 14,434,330 I465N probably benign Het
Spcs1 T A 14: 31,001,650 probably benign Het
Stard9 T C 2: 120,699,379 V2039A probably benign Het
Syt11 G T 3: 88,762,471 T38K possibly damaging Het
Tcf7l2 T A 19: 55,926,036 C454S probably damaging Het
Tfap2a G C 13: 40,725,180 H155D probably benign Het
Trim46 T C 3: 89,242,258 K273R probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Ttc39d G A 17: 80,217,312 A467T probably damaging Het
Ttn T C 2: 76,719,930 T31636A probably benign Het
U2surp A G 9: 95,488,761 V420A probably damaging Het
Vps26b T C 9: 27,029,530 D31G probably benign Het
Vps35 T C 8: 85,284,078 E212G possibly damaging Het
Other mutations in Nostrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nostrin APN 2 69185554 splice site probably benign
IGL00502:Nostrin APN 2 69183992 missense probably benign
IGL00767:Nostrin APN 2 69175775 missense probably benign 0.00
IGL00846:Nostrin APN 2 69185555 splice site probably benign
IGL00912:Nostrin APN 2 69182819 splice site probably benign
IGL02123:Nostrin APN 2 69156109 splice site probably benign
IGL02213:Nostrin APN 2 69183918 missense probably benign 0.25
R0295:Nostrin UTSW 2 69179416 missense probably benign 0.19
R0543:Nostrin UTSW 2 69189131 makesense probably null
R1384:Nostrin UTSW 2 69189062 missense probably benign 0.05
R1501:Nostrin UTSW 2 69158785 missense probably damaging 1.00
R1632:Nostrin UTSW 2 69175734 missense probably benign 0.21
R2012:Nostrin UTSW 2 69144767 splice site probably null
R2140:Nostrin UTSW 2 69166003 missense probably damaging 0.98
R2159:Nostrin UTSW 2 69180922 splice site probably null
R2329:Nostrin UTSW 2 69161094 missense probably damaging 1.00
R2890:Nostrin UTSW 2 69180905 missense probably benign
R4469:Nostrin UTSW 2 69175717 missense probably damaging 0.99
R4607:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4608:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4684:Nostrin UTSW 2 69183924 missense probably benign 0.00
R4719:Nostrin UTSW 2 69144812 nonsense probably null
R4846:Nostrin UTSW 2 69175579 missense probably damaging 1.00
R4911:Nostrin UTSW 2 69161142 missense possibly damaging 0.87
R4987:Nostrin UTSW 2 69156431 missense probably benign
R5054:Nostrin UTSW 2 69175713 missense possibly damaging 0.82
R5177:Nostrin UTSW 2 69175754 missense possibly damaging 0.83
R6561:Nostrin UTSW 2 69180857 missense probably benign
R6785:Nostrin UTSW 2 69183927 missense probably benign 0.01
R6789:Nostrin UTSW 2 69175512 missense probably benign
R7453:Nostrin UTSW 2 69183896 missense possibly damaging 0.95
R7465:Nostrin UTSW 2 69185507 missense possibly damaging 0.93
R7570:Nostrin UTSW 2 69175806 missense probably damaging 0.98
R7802:Nostrin UTSW 2 69189012 missense probably benign 0.18
R8115:Nostrin UTSW 2 69180920 critical splice donor site probably null
R8160:Nostrin UTSW 2 69179466 missense probably damaging 0.98
X0021:Nostrin UTSW 2 69144792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATACTTGCTGCTATGCTATTTGGG -3'
(R):5'- TTCACGCTTGGTTAACCTCAG -3'

Sequencing Primer
(F):5'- CATATTTTGGGATGAAGGATGGAAAC -3'
(R):5'- TTGGTTAACCTCAGATCCCTACAGAG -3'
Posted On2019-11-26