Incidental Mutation 'R7761:Trim46'
ID597850
Institutional Source Beutler Lab
Gene Symbol Trim46
Ensembl Gene ENSMUSG00000042766
Gene Nametripartite motif-containing 46
SynonymsTRIFIC
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R7761 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89234177-89246309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89242258 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 273 (K273R)
Ref Sequence ENSEMBL: ENSMUSP00000036053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040888] [ENSMUST00000041022] [ENSMUST00000090924] [ENSMUST00000107464] [ENSMUST00000125952] [ENSMUST00000143637] [ENSMUST00000168900]
Predicted Effect probably benign
Transcript: ENSMUST00000040888
SMART Domains Protein: ENSMUSP00000043540
Gene: ENSMUSG00000042747

DomainStartEndE-ValueType
Pfam:Keratin_assoc 87 215 2.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041022
AA Change: K273R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036053
Gene: ENSMUSG00000042766
AA Change: K273R

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 271 395 3e-13 BLAST
FN3 430 515 2.03e-2 SMART
low complexity region 561 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090924
AA Change: K260R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088442
Gene: ENSMUSG00000042766
AA Change: K260R

DomainStartEndE-ValueType
RING 20 120 1.92e-6 SMART
BBOX 209 250 9.59e-7 SMART
Blast:BBC 258 382 8e-13 BLAST
FN3 417 502 2.03e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107464
AA Change: K250R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103088
Gene: ENSMUSG00000042766
AA Change: K250R

DomainStartEndE-ValueType
RING 10 110 1.92e-6 SMART
BBOX 199 240 9.59e-7 SMART
Blast:BBC 248 372 2e-13 BLAST
FN3 407 492 2.03e-2 SMART
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125952
Predicted Effect probably damaging
Transcript: ENSMUST00000143637
AA Change: K273R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119270
Gene: ENSMUSG00000042766
AA Change: K273R

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 270 391 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168900
SMART Domains Protein: ENSMUSP00000130372
Gene: ENSMUSG00000042747

DomainStartEndE-ValueType
Pfam:Keratin_assoc 1 134 1.2e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,330,288 C378Y probably damaging Het
Adcy6 A C 15: 98,600,014 L421R probably damaging Het
AI837181 A G 19: 5,426,291 T161A probably benign Het
Ascl2 A G 7: 142,968,103 S203P possibly damaging Het
Casq2 G T 3: 102,145,264 W364L probably damaging Het
Cdc20 T C 4: 118,435,989 T245A possibly damaging Het
Cfap99 C T 5: 34,323,430 Q475* probably null Het
Chmp2b G A 16: 65,546,859 T104I possibly damaging Het
Cln3 A T 7: 126,581,714 Y52N probably damaging Het
Cpm A G 10: 117,683,435 Y416C possibly damaging Het
Creb3l3 T C 10: 81,084,999 D399G possibly damaging Het
Dbnl A G 11: 5,788,597 Q13R probably benign Het
Dnah11 T A 12: 118,023,913 Q2418L probably damaging Het
Echs1 A T 7: 140,112,465 I123N probably damaging Het
Exd2 T C 12: 80,475,772 S2P probably damaging Het
F2rl1 A G 13: 95,513,874 F167L probably damaging Het
Fam83g C A 11: 61,684,758 D75E possibly damaging Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Ggnbp2 A T 11: 84,839,977 probably null Het
Gm10031 A T 1: 156,525,137 K303* probably null Het
Gm10283 A T 8: 60,501,202 probably null Het
Gm14409 T C 2: 177,265,517 I63V possibly damaging Het
Gm14410 T C 2: 177,193,734 N246D probably benign Het
Gpr39 A T 1: 125,677,512 Q59L probably damaging Het
Hic1 C T 11: 75,167,374 A230T probably damaging Het
Hmcn1 A G 1: 150,722,445 L1702P possibly damaging Het
Kif13a A T 13: 46,798,479 Y773N probably benign Het
Lins1 A T 7: 66,714,105 R583* probably null Het
Lrch4 T A 5: 137,639,763 H102Q Het
Ltn1 T C 16: 87,411,793 T806A probably benign Het
Luc7l2 G A 6: 38,555,064 probably null Het
Mdfic T C 6: 15,728,056 I25T unknown Het
Muc16 G T 9: 18,580,574 T6727N probably damaging Het
Nalcn C A 14: 123,294,379 G1353V probably damaging Het
Nalcn C G 14: 123,294,380 G1353R probably damaging Het
Nbeal1 C T 1: 60,319,341 P2476S probably benign Het
Nell2 T C 15: 95,432,669 T233A probably damaging Het
Nobox G A 6: 43,304,191 Q450* probably null Het
Nostrin T G 2: 69,161,122 L153R possibly damaging Het
Nup160 T C 2: 90,703,112 V635A probably benign Het
Odf3l1 A G 9: 56,852,538 L16P unknown Het
Olfr1276 T C 2: 111,257,174 S20P possibly damaging Het
Olfr1283 C T 2: 111,368,793 H54Y probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Olfr682-ps1 A G 7: 105,126,719 I184T probably benign Het
Opn4 T A 14: 34,598,852 M84L probably benign Het
Papolg T C 11: 23,891,884 Q13R probably benign Het
Pax6 T G 2: 105,691,691 F231C probably damaging Het
Pcdha3 T C 18: 36,946,294 Y30H probably damaging Het
Pkhd1l1 A G 15: 44,529,884 T1872A probably benign Het
Pln T C 10: 53,343,909 S16P probably damaging Het
Ppp4r3a C T 12: 101,055,821 E308K probably damaging Het
Prp2 C T 6: 132,600,343 Q198* probably null Het
Ptpn20 T A 14: 33,622,552 S144R probably benign Het
Pum3 A T 19: 27,427,092 F10L probably benign Het
Rapgefl1 A T 11: 98,837,659 D169V probably benign Het
Rbm12b1 T C 4: 12,146,460 Y811H possibly damaging Het
Rcor1 T A 12: 111,109,863 F418L Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd11 T C 4: 156,247,825 T520A probably benign Het
Scn3a T A 2: 65,529,454 T137S possibly damaging Het
Sgo2b T C 8: 63,926,912 N962S probably benign Het
Slc39a12 T A 2: 14,434,330 I465N probably benign Het
Spcs1 T A 14: 31,001,650 probably benign Het
Stard9 T C 2: 120,699,379 V2039A probably benign Het
Syt11 G T 3: 88,762,471 T38K possibly damaging Het
Tcf7l2 T A 19: 55,926,036 C454S probably damaging Het
Tfap2a G C 13: 40,725,180 H155D probably benign Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Ttc39d G A 17: 80,217,312 A467T probably damaging Het
Ttn T C 2: 76,719,930 T31636A probably benign Het
U2surp A G 9: 95,488,761 V420A probably damaging Het
Vps26b T C 9: 27,029,530 D31G probably benign Het
Vps35 T C 8: 85,284,078 E212G possibly damaging Het
Other mutations in Trim46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Trim46 APN 3 89244418 unclassified probably benign
IGL02082:Trim46 APN 3 89239000 missense probably benign 0.03
IGL02405:Trim46 APN 3 89242485 missense probably benign 0.09
R0107:Trim46 UTSW 3 89236333 missense probably damaging 1.00
R0295:Trim46 UTSW 3 89245113 unclassified probably benign
R0330:Trim46 UTSW 3 89236513 missense probably damaging 1.00
R1303:Trim46 UTSW 3 89242208 missense probably benign 0.03
R1436:Trim46 UTSW 3 89243661 missense probably damaging 1.00
R1458:Trim46 UTSW 3 89235068 unclassified probably null
R1990:Trim46 UTSW 3 89237701 missense probably damaging 1.00
R1991:Trim46 UTSW 3 89237701 missense probably damaging 1.00
R1992:Trim46 UTSW 3 89237701 missense probably damaging 1.00
R2102:Trim46 UTSW 3 89235197 missense probably damaging 1.00
R3729:Trim46 UTSW 3 89234949 missense probably benign
R3730:Trim46 UTSW 3 89234949 missense probably benign
R4603:Trim46 UTSW 3 89243651 missense probably benign 0.11
R6648:Trim46 UTSW 3 89235242 missense possibly damaging 0.88
R6962:Trim46 UTSW 3 89238996 missense probably damaging 1.00
R7905:Trim46 UTSW 3 89244326 missense probably damaging 1.00
R7988:Trim46 UTSW 3 89244326 missense probably damaging 1.00
X0021:Trim46 UTSW 3 89243709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCTGAACTGGCAGTAAGAC -3'
(R):5'- GAGGTGACCCACTACTGTAAGAC -3'

Sequencing Primer
(F):5'- CTCTGAACTGGCAGTAAGACAATGG -3'
(R):5'- ACATGTCAACGACTGGTGTGC -3'
Posted On2019-11-26