Incidental Mutation 'R7761:Casq2'
ID597851
Institutional Source Beutler Lab
Gene Symbol Casq2
Ensembl Gene ENSMUSG00000027861
Gene Namecalsequestrin 2
SynonymsESTM52, cCSQ, cardiac calsequestrin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7761 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location102086415-102146514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102145264 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 364 (W364L)
Ref Sequence ENSEMBL: ENSMUSP00000130482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029454] [ENSMUST00000164123] [ENSMUST00000165540]
Predicted Effect probably damaging
Transcript: ENSMUST00000029454
AA Change: W361L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029454
Gene: ENSMUSG00000027861
AA Change: W361L

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 382 1.4e-226 PFAM
Pfam:Thioredoxin_6 171 364 7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164123
AA Change: W290L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131232
Gene: ENSMUSG00000027861
AA Change: W290L

DomainStartEndE-ValueType
Pfam:Calsequestrin 2 108 1.3e-46 PFAM
Pfam:Thioredoxin_6 101 293 6.1e-20 PFAM
Pfam:Calsequestrin 106 311 1.9e-127 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165540
AA Change: W364L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130482
Gene: ENSMUSG00000027861
AA Change: W364L

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 386 7.4e-224 PFAM
Pfam:Thioredoxin_6 171 367 9.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause impaired intracellular calcium regulation in cardiac myocytes and lead to an arrhythmogenic syndrome called catecholaminergic polymorphic ventricular tachycardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,330,288 C378Y probably damaging Het
Adcy6 A C 15: 98,600,014 L421R probably damaging Het
AI837181 A G 19: 5,426,291 T161A probably benign Het
Ascl2 A G 7: 142,968,103 S203P possibly damaging Het
Cdc20 T C 4: 118,435,989 T245A possibly damaging Het
Cfap99 C T 5: 34,323,430 Q475* probably null Het
Chmp2b G A 16: 65,546,859 T104I possibly damaging Het
Cln3 A T 7: 126,581,714 Y52N probably damaging Het
Cpm A G 10: 117,683,435 Y416C possibly damaging Het
Creb3l3 T C 10: 81,084,999 D399G possibly damaging Het
Dbnl A G 11: 5,788,597 Q13R probably benign Het
Dnah11 T A 12: 118,023,913 Q2418L probably damaging Het
Echs1 A T 7: 140,112,465 I123N probably damaging Het
Exd2 T C 12: 80,475,772 S2P probably damaging Het
F2rl1 A G 13: 95,513,874 F167L probably damaging Het
Fam83g C A 11: 61,684,758 D75E possibly damaging Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Ggnbp2 A T 11: 84,839,977 probably null Het
Gm10031 A T 1: 156,525,137 K303* probably null Het
Gm10283 A T 8: 60,501,202 probably null Het
Gm14409 T C 2: 177,265,517 I63V possibly damaging Het
Gm14410 T C 2: 177,193,734 N246D probably benign Het
Gpr39 A T 1: 125,677,512 Q59L probably damaging Het
Hic1 C T 11: 75,167,374 A230T probably damaging Het
Hmcn1 A G 1: 150,722,445 L1702P possibly damaging Het
Kif13a A T 13: 46,798,479 Y773N probably benign Het
Lins1 A T 7: 66,714,105 R583* probably null Het
Lrch4 T A 5: 137,639,763 H102Q Het
Ltn1 T C 16: 87,411,793 T806A probably benign Het
Luc7l2 G A 6: 38,555,064 probably null Het
Mdfic T C 6: 15,728,056 I25T unknown Het
Muc16 G T 9: 18,580,574 T6727N probably damaging Het
Nalcn C A 14: 123,294,379 G1353V probably damaging Het
Nalcn C G 14: 123,294,380 G1353R probably damaging Het
Nbeal1 C T 1: 60,319,341 P2476S probably benign Het
Nell2 T C 15: 95,432,669 T233A probably damaging Het
Nobox G A 6: 43,304,191 Q450* probably null Het
Nostrin T G 2: 69,161,122 L153R possibly damaging Het
Nup160 T C 2: 90,703,112 V635A probably benign Het
Odf3l1 A G 9: 56,852,538 L16P unknown Het
Olfr1276 T C 2: 111,257,174 S20P possibly damaging Het
Olfr1283 C T 2: 111,368,793 H54Y probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Olfr682-ps1 A G 7: 105,126,719 I184T probably benign Het
Opn4 T A 14: 34,598,852 M84L probably benign Het
Papolg T C 11: 23,891,884 Q13R probably benign Het
Pax6 T G 2: 105,691,691 F231C probably damaging Het
Pcdha3 T C 18: 36,946,294 Y30H probably damaging Het
Pkhd1l1 A G 15: 44,529,884 T1872A probably benign Het
Pln T C 10: 53,343,909 S16P probably damaging Het
Ppp4r3a C T 12: 101,055,821 E308K probably damaging Het
Prp2 C T 6: 132,600,343 Q198* probably null Het
Ptpn20 T A 14: 33,622,552 S144R probably benign Het
Pum3 A T 19: 27,427,092 F10L probably benign Het
Rapgefl1 A T 11: 98,837,659 D169V probably benign Het
Rbm12b1 T C 4: 12,146,460 Y811H possibly damaging Het
Rcor1 T A 12: 111,109,863 F418L Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd11 T C 4: 156,247,825 T520A probably benign Het
Scn3a T A 2: 65,529,454 T137S possibly damaging Het
Sgo2b T C 8: 63,926,912 N962S probably benign Het
Slc39a12 T A 2: 14,434,330 I465N probably benign Het
Spcs1 T A 14: 31,001,650 probably benign Het
Stard9 T C 2: 120,699,379 V2039A probably benign Het
Syt11 G T 3: 88,762,471 T38K possibly damaging Het
Tcf7l2 T A 19: 55,926,036 C454S probably damaging Het
Tfap2a G C 13: 40,725,180 H155D probably benign Het
Trim46 T C 3: 89,242,258 K273R probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Ttc39d G A 17: 80,217,312 A467T probably damaging Het
Ttn T C 2: 76,719,930 T31636A probably benign Het
U2surp A G 9: 95,488,761 V420A probably damaging Het
Vps26b T C 9: 27,029,530 D31G probably benign Het
Vps35 T C 8: 85,284,078 E212G possibly damaging Het
Other mutations in Casq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Casq2 APN 3 102110231 splice site probably benign
IGL02597:Casq2 APN 3 102126637 missense probably damaging 1.00
IGL02863:Casq2 APN 3 102144175 missense possibly damaging 0.84
IGL02902:Casq2 APN 3 102086797 nonsense probably null
IGL03176:Casq2 APN 3 102126654 missense possibly damaging 0.50
R0126:Casq2 UTSW 3 102133399 missense probably damaging 1.00
R0653:Casq2 UTSW 3 102113166 critical splice donor site probably null
R1036:Casq2 UTSW 3 102142215 missense probably damaging 1.00
R1052:Casq2 UTSW 3 102144234 splice site probably null
R1158:Casq2 UTSW 3 102116883 missense probably damaging 1.00
R2886:Casq2 UTSW 3 102144218 missense probably damaging 1.00
R3001:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R3002:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R4155:Casq2 UTSW 3 102133102 splice site probably null
R4715:Casq2 UTSW 3 102110244 missense probably benign 0.00
R6013:Casq2 UTSW 3 102145629 unclassified probably null
R6778:Casq2 UTSW 3 102127931 splice site probably null
R6836:Casq2 UTSW 3 102086760 missense probably damaging 1.00
R6844:Casq2 UTSW 3 102110262 missense possibly damaging 0.70
R7055:Casq2 UTSW 3 102142245 missense probably damaging 1.00
R7638:Casq2 UTSW 3 102086700 missense possibly damaging 0.73
R7997:Casq2 UTSW 3 102086842 missense probably damaging 0.98
R8169:Casq2 UTSW 3 102110312 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGCAACTTGGCATTTGCATTTG -3'
(R):5'- CTCATCAGAATCACCCAGGG -3'

Sequencing Primer
(F):5'- TGTATTCCTGCTAGGTATTAGAGAC -3'
(R):5'- CAGGGCTGGAGCTATTCATC -3'
Posted On2019-11-26