Incidental Mutation 'R7761:F2rl1'
ID597890
Institutional Source Beutler Lab
Gene Symbol F2rl1
Ensembl Gene ENSMUSG00000021678
Gene Namecoagulation factor II (thrombin) receptor-like 1
Synonymsproteinase-activated receptor-2, PAR-2, Par2, Gpcr11, Protease-activated receptor-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7761 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95511732-95525227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95513874 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 167 (F167L)
Ref Sequence ENSEMBL: ENSMUSP00000022185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022185]
Predicted Effect probably damaging
Transcript: ENSMUST00000022185
AA Change: F167L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022185
Gene: ENSMUSG00000021678
AA Change: F167L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 75 363 3.8e-12 PFAM
Pfam:7TM_GPCR_Srw 82 364 1.2e-10 PFAM
Pfam:7tm_1 94 346 1.5e-42 PFAM
low complexity region 375 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 1 family of proteins. The encoded cell surface receptor is activated through proteolytic cleavage of its extracellular amino terminus, resulting in a new amino terminus that acts as a tethered ligand that binds to an extracellular loop domain. Activation of the receptor has been shown to stimulate vascular smooth muscle relaxation, dilate blood vessels, increase blood flow, and lower blood pressure. This protein is also important in the inflammatory response, as well as innate and adaptive immunity. [provided by RefSeq, Jun 2016]
PHENOTYPE: Nullizygous mice may exhibit impaired leukocyte rolling and dendritic cell maturation, altered inflammatory response in various models of acute and chronic inflammatory disease, altered susceptibility to injury and to autoimmune disorders, and abnormal hemodynamic responses and pain thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,330,288 C378Y probably damaging Het
Adcy6 A C 15: 98,600,014 L421R probably damaging Het
AI837181 A G 19: 5,426,291 T161A probably benign Het
Ascl2 A G 7: 142,968,103 S203P possibly damaging Het
Casq2 G T 3: 102,145,264 W364L probably damaging Het
Cdc20 T C 4: 118,435,989 T245A possibly damaging Het
Cfap99 C T 5: 34,323,430 Q475* probably null Het
Chmp2b G A 16: 65,546,859 T104I possibly damaging Het
Cln3 A T 7: 126,581,714 Y52N probably damaging Het
Cpm A G 10: 117,683,435 Y416C possibly damaging Het
Creb3l3 T C 10: 81,084,999 D399G possibly damaging Het
Dbnl A G 11: 5,788,597 Q13R probably benign Het
Dnah11 T A 12: 118,023,913 Q2418L probably damaging Het
Echs1 A T 7: 140,112,465 I123N probably damaging Het
Exd2 T C 12: 80,475,772 S2P probably damaging Het
Fam83g C A 11: 61,684,758 D75E possibly damaging Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Ggnbp2 A T 11: 84,839,977 probably null Het
Gm10031 A T 1: 156,525,137 K303* probably null Het
Gm10283 A T 8: 60,501,202 probably null Het
Gm14409 T C 2: 177,265,517 I63V possibly damaging Het
Gm14410 T C 2: 177,193,734 N246D probably benign Het
Gpr39 A T 1: 125,677,512 Q59L probably damaging Het
Hic1 C T 11: 75,167,374 A230T probably damaging Het
Hmcn1 A G 1: 150,722,445 L1702P possibly damaging Het
Kif13a A T 13: 46,798,479 Y773N probably benign Het
Lins1 A T 7: 66,714,105 R583* probably null Het
Lrch4 T A 5: 137,639,763 H102Q Het
Ltn1 T C 16: 87,411,793 T806A probably benign Het
Luc7l2 G A 6: 38,555,064 probably null Het
Mdfic T C 6: 15,728,056 I25T unknown Het
Muc16 G T 9: 18,580,574 T6727N probably damaging Het
Nalcn C A 14: 123,294,379 G1353V probably damaging Het
Nalcn C G 14: 123,294,380 G1353R probably damaging Het
Nbeal1 C T 1: 60,319,341 P2476S probably benign Het
Nell2 T C 15: 95,432,669 T233A probably damaging Het
Nobox G A 6: 43,304,191 Q450* probably null Het
Nostrin T G 2: 69,161,122 L153R possibly damaging Het
Nup160 T C 2: 90,703,112 V635A probably benign Het
Odf3l1 A G 9: 56,852,538 L16P unknown Het
Olfr1276 T C 2: 111,257,174 S20P possibly damaging Het
Olfr1283 C T 2: 111,368,793 H54Y probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Olfr682-ps1 A G 7: 105,126,719 I184T probably benign Het
Opn4 T A 14: 34,598,852 M84L probably benign Het
Papolg T C 11: 23,891,884 Q13R probably benign Het
Pax6 T G 2: 105,691,691 F231C probably damaging Het
Pcdha3 T C 18: 36,946,294 Y30H probably damaging Het
Pkhd1l1 A G 15: 44,529,884 T1872A probably benign Het
Pln T C 10: 53,343,909 S16P probably damaging Het
Ppp4r3a C T 12: 101,055,821 E308K probably damaging Het
Prp2 C T 6: 132,600,343 Q198* probably null Het
Ptpn20 T A 14: 33,622,552 S144R probably benign Het
Pum3 A T 19: 27,427,092 F10L probably benign Het
Rapgefl1 A T 11: 98,837,659 D169V probably benign Het
Rbm12b1 T C 4: 12,146,460 Y811H possibly damaging Het
Rcor1 T A 12: 111,109,863 F418L Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd11 T C 4: 156,247,825 T520A probably benign Het
Scn3a T A 2: 65,529,454 T137S possibly damaging Het
Sgo2b T C 8: 63,926,912 N962S probably benign Het
Slc39a12 T A 2: 14,434,330 I465N probably benign Het
Spcs1 T A 14: 31,001,650 probably benign Het
Stard9 T C 2: 120,699,379 V2039A probably benign Het
Syt11 G T 3: 88,762,471 T38K possibly damaging Het
Tcf7l2 T A 19: 55,926,036 C454S probably damaging Het
Tfap2a G C 13: 40,725,180 H155D probably benign Het
Trim46 T C 3: 89,242,258 K273R probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Ttc39d G A 17: 80,217,312 A467T probably damaging Het
Ttn T C 2: 76,719,930 T31636A probably benign Het
U2surp A G 9: 95,488,761 V420A probably damaging Het
Vps26b T C 9: 27,029,530 D31G probably benign Het
Vps35 T C 8: 85,284,078 E212G possibly damaging Het
Other mutations in F2rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:F2rl1 APN 13 95513753 missense probably benign 0.03
IGL01996:F2rl1 APN 13 95513924 missense probably damaging 1.00
IGL02987:F2rl1 APN 13 95514233 missense probably benign 0.00
IGL03053:F2rl1 APN 13 95513618 missense probably benign 0.03
IGL03290:F2rl1 APN 13 95513589 missense possibly damaging 0.89
PIT4382001:F2rl1 UTSW 13 95513646 missense probably benign 0.00
R2005:F2rl1 UTSW 13 95513274 missense probably damaging 1.00
R3794:F2rl1 UTSW 13 95513211 missense unknown
R4236:F2rl1 UTSW 13 95513288 missense probably damaging 1.00
R4715:F2rl1 UTSW 13 95513267 missense probably damaging 0.99
R4741:F2rl1 UTSW 13 95514143 missense probably damaging 1.00
R4799:F2rl1 UTSW 13 95513969 missense possibly damaging 0.81
R4870:F2rl1 UTSW 13 95513984 missense probably damaging 0.99
R5992:F2rl1 UTSW 13 95514270 missense probably benign 0.01
R6276:F2rl1 UTSW 13 95513938 nonsense probably null
R7568:F2rl1 UTSW 13 95514014 missense probably damaging 1.00
R8087:F2rl1 UTSW 13 95513999 missense probably damaging 1.00
R8281:F2rl1 UTSW 13 95514077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGCTGGAATGTAGATGGTCTG -3'
(R):5'- TTGGTTTGCCCAGTAATGGC -3'

Sequencing Primer
(F):5'- GTCTGCTTCATGACATACAAAGGG -3'
(R):5'- GGATCTTCCTTTTCCGAACGAAGAAG -3'
Posted On2019-11-26