Incidental Mutation 'R7762:Tmeff2'
ID597907
Institutional Source Beutler Lab
Gene Symbol Tmeff2
Ensembl Gene ENSMUSG00000026109
Gene Nametransmembrane protein with EGF-like and two follistatin-like domains 2
Synonyms4832418D20Rik, 7630402F16Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location50900647-51187270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50979416 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 186 (N186Y)
Ref Sequence ENSEMBL: ENSMUSP00000110212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081851] [ENSMUST00000114565]
Predicted Effect probably benign
Transcript: ENSMUST00000081851
SMART Domains Protein: ENSMUSP00000080533
Gene: ENSMUSG00000026109

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
KAZAL 181 227 6.05e-13 SMART
EGF 264 301 3.57e-2 SMART
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114565
AA Change: N186Y

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110212
Gene: ENSMUSG00000026109
AA Change: N186Y

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tomoregulin family of transmembrane proteins. This protein has been shown to function as both an oncogene and a tumor suppressor depending on the cellular context and may regulate prostate cancer cell invasion. Multiple soluble forms of this protein have been identified that arise from both an alternative splice variant and ectodomain shedding. Additionally, this gene has been found to be hypermethylated in multiple cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele display slow postnatal weight gain, decreased white adipose tissue amount, and complete lethality at weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Ccr9 A T 9: 123,779,957 T235S probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clk2 G A 3: 89,167,191 V53I probably benign Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
Eral1 A G 11: 78,074,533 I352T possibly damaging Het
F2 T C 2: 91,628,696 H476R possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Obsl1 A T 1: 75,503,523 C460S probably benign Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Orai3 G A 7: 127,773,571 G130S unknown Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trpv1 G T 11: 73,254,222 K711N probably benign Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in Tmeff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Tmeff2 APN 1 51185450 missense probably damaging 1.00
IGL00707:Tmeff2 APN 1 51133053 splice site probably null
IGL01096:Tmeff2 APN 1 50930546 splice site probably benign
IGL01897:Tmeff2 APN 1 51132210 missense probably damaging 1.00
IGL02797:Tmeff2 APN 1 50928047 missense probably damaging 1.00
IGL03245:Tmeff2 APN 1 51181817 missense probably benign 0.30
R0454:Tmeff2 UTSW 1 50928075 missense possibly damaging 0.92
R0975:Tmeff2 UTSW 1 50938205 splice site probably benign
R1161:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1310:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1457:Tmeff2 UTSW 1 51181867 missense probably damaging 1.00
R3001:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3002:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3424:Tmeff2 UTSW 1 50979617 intron probably benign
R4807:Tmeff2 UTSW 1 50979387 missense probably benign 0.01
R4923:Tmeff2 UTSW 1 50930645 missense probably benign 0.29
R4977:Tmeff2 UTSW 1 50979556 nonsense probably null
R5176:Tmeff2 UTSW 1 51071541 nonsense probably null
R5220:Tmeff2 UTSW 1 50979317 missense probably benign 0.01
R5919:Tmeff2 UTSW 1 51132152 nonsense probably null
R5990:Tmeff2 UTSW 1 50979442 nonsense probably null
R6353:Tmeff2 UTSW 1 51181826 missense probably damaging 1.00
R6358:Tmeff2 UTSW 1 51133114 nonsense probably null
R6925:Tmeff2 UTSW 1 50928021 missense probably damaging 0.99
R7114:Tmeff2 UTSW 1 51185245 intron probably null
R7163:Tmeff2 UTSW 1 50938344 critical splice donor site probably null
R7332:Tmeff2 UTSW 1 50979440 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCTGCCAGAGTTCTTTTAAC -3'
(R):5'- TGGTATTGTTCCCTTCAACACAG -3'

Sequencing Primer
(F):5'- GTTCCTTGACGTGAATCTGGATATAC -3'
(R):5'- GTATTGTTCCCTTCAACACAGTCCAC -3'
Posted On2019-11-26