Incidental Mutation 'R7762:Obsl1'
ID597909
Institutional Source Beutler Lab
Gene Symbol Obsl1
Ensembl Gene ENSMUSG00000026211
Gene Nameobscurin-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75479310-75506452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75503523 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 460 (C460S)
Ref Sequence ENSEMBL: ENSMUSP00000109197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037330] [ENSMUST00000113565] [ENSMUST00000113567]
Predicted Effect probably benign
Transcript: ENSMUST00000037330
SMART Domains Protein: ENSMUSP00000040310
Gene: ENSMUSG00000032968

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 189 199 N/A INTRINSIC
TGFB 263 366 1.58e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113565
AA Change: C460S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109195
Gene: ENSMUSG00000026211
AA Change: C460S

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 5e-57 PDB
Blast:IG_like 622 711 2e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113567
AA Change: C460S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109197
Gene: ENSMUSG00000026211
AA Change: C460S

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 8e-57 PDB
Blast:IG_like 622 711 3e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
IG 996 1075 1.27e-5 SMART
IGc2 1094 1160 4.07e-4 SMART
IGc2 1186 1252 9.49e-5 SMART
IG 1274 1353 7.41e-7 SMART
IG 1363 1444 1.15e-3 SMART
IG 1454 1533 8.33e-1 SMART
IGc2 1549 1615 8.72e-4 SMART
IG 1633 1712 1e-3 SMART
IG 1723 1802 3.82e-9 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114553
Gene: ENSMUSG00000026211
AA Change: C265S

DomainStartEndE-ValueType
SCOP:d1g1ca_ 2 32 1e-3 SMART
IGc2 64 132 1.48e-6 SMART
IG 153 233 9.49e-5 SMART
IG 241 317 1.04e-1 SMART
FN3 324 407 6.6e-2 SMART
PDB:2E6Q|A 414 520 4e-57 PDB
Blast:IG_like 428 517 2e-50 BLAST
IG 529 610 3.79e-4 SMART
IG 620 699 2.58e-6 SMART
IGc2 717 783 1.12e-6 SMART
IG 802 881 1.27e-5 SMART
IGc2 900 966 4.07e-4 SMART
IGc2 992 1058 9.49e-5 SMART
IG 1080 1159 7.41e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Ccr9 A T 9: 123,779,957 T235S probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clk2 G A 3: 89,167,191 V53I probably benign Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
Eral1 A G 11: 78,074,533 I352T possibly damaging Het
F2 T C 2: 91,628,696 H476R possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Orai3 G A 7: 127,773,571 G130S unknown Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmeff2 A T 1: 50,979,416 N186Y probably benign Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trpv1 G T 11: 73,254,222 K711N probably benign Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in Obsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Obsl1 APN 1 75490874 missense probably benign 0.02
IGL01111:Obsl1 APN 1 75497145 missense possibly damaging 0.62
IGL01140:Obsl1 APN 1 75489756 unclassified probably benign
IGL02149:Obsl1 APN 1 75503820 missense probably damaging 1.00
IGL02225:Obsl1 APN 1 75503798 missense probably damaging 0.99
IGL02269:Obsl1 APN 1 75487713 missense probably damaging 0.97
IGL02296:Obsl1 APN 1 75498149 missense possibly damaging 0.94
IGL02386:Obsl1 APN 1 75492517 missense probably damaging 1.00
IGL02408:Obsl1 APN 1 75505246 missense probably damaging 0.98
IGL02601:Obsl1 APN 1 75489620 missense probably benign
IGL03053:Obsl1 APN 1 75493079 missense probably benign
IGL03181:Obsl1 APN 1 75492584 missense probably benign 0.00
IGL03402:Obsl1 APN 1 75486799 missense probably benign 0.00
PIT1430001:Obsl1 UTSW 1 75506167 missense probably damaging 1.00
PIT4382001:Obsl1 UTSW 1 75487963 missense probably benign 0.06
R0281:Obsl1 UTSW 1 75492927 missense probably damaging 1.00
R1343:Obsl1 UTSW 1 75492579 missense probably damaging 1.00
R1394:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1395:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1439:Obsl1 UTSW 1 75486784 nonsense probably null
R1456:Obsl1 UTSW 1 75487656 nonsense probably null
R1728:Obsl1 UTSW 1 75486756 missense probably benign
R1729:Obsl1 UTSW 1 75486756 missense probably benign
R1730:Obsl1 UTSW 1 75486756 missense probably benign
R1739:Obsl1 UTSW 1 75486756 missense probably benign
R1757:Obsl1 UTSW 1 75493883 missense probably benign
R1762:Obsl1 UTSW 1 75486756 missense probably benign
R1783:Obsl1 UTSW 1 75486756 missense probably benign
R1784:Obsl1 UTSW 1 75486756 missense probably benign
R1785:Obsl1 UTSW 1 75486756 missense probably benign
R1851:Obsl1 UTSW 1 75492893 missense probably damaging 1.00
R1864:Obsl1 UTSW 1 75493109 missense probably benign 0.01
R1873:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1875:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1980:Obsl1 UTSW 1 75505836 missense probably damaging 1.00
R1985:Obsl1 UTSW 1 75505600 missense probably damaging 1.00
R2049:Obsl1 UTSW 1 75486756 missense probably benign
R2069:Obsl1 UTSW 1 75486756 missense probably benign
R2122:Obsl1 UTSW 1 75493883 missense probably benign
R2141:Obsl1 UTSW 1 75486756 missense probably benign
R2142:Obsl1 UTSW 1 75486756 missense probably benign
R2184:Obsl1 UTSW 1 75502217 missense probably benign 0.26
R2267:Obsl1 UTSW 1 75505698 missense probably damaging 1.00
R2883:Obsl1 UTSW 1 75496511 missense possibly damaging 0.73
R3079:Obsl1 UTSW 1 75490823 missense probably damaging 1.00
R3749:Obsl1 UTSW 1 75498246 missense probably benign
R4002:Obsl1 UTSW 1 75500099 missense possibly damaging 0.90
R4365:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4366:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4414:Obsl1 UTSW 1 75490902 missense probably benign 0.00
R4700:Obsl1 UTSW 1 75503441 missense probably damaging 1.00
R4799:Obsl1 UTSW 1 75489501 missense possibly damaging 0.93
R5081:Obsl1 UTSW 1 75487963 missense possibly damaging 0.49
R5389:Obsl1 UTSW 1 75503261 intron probably benign
R5757:Obsl1 UTSW 1 75493055 missense probably damaging 0.98
R5890:Obsl1 UTSW 1 75493859 missense probably damaging 1.00
R5946:Obsl1 UTSW 1 75491207 missense probably damaging 0.96
R6005:Obsl1 UTSW 1 75492215 unclassified probably null
R6118:Obsl1 UTSW 1 75492078 intron probably benign
R6154:Obsl1 UTSW 1 75500144 missense probably benign 0.19
R6317:Obsl1 UTSW 1 75489629 missense possibly damaging 0.50
R6379:Obsl1 UTSW 1 75503143 missense probably damaging 1.00
R6387:Obsl1 UTSW 1 75491362 missense probably benign 0.03
R7084:Obsl1 UTSW 1 75487750 missense probably benign
R7123:Obsl1 UTSW 1 75489669 missense probably damaging 1.00
R7202:Obsl1 UTSW 1 75489716 missense possibly damaging 0.94
R7291:Obsl1 UTSW 1 75489517 missense probably damaging 0.98
R7305:Obsl1 UTSW 1 75493946 nonsense probably null
R7366:Obsl1 UTSW 1 75502964 missense probably damaging 1.00
R7402:Obsl1 UTSW 1 75487704 missense probably benign
R7474:Obsl1 UTSW 1 75498184 missense probably benign 0.00
R7611:Obsl1 UTSW 1 75505380 missense probably damaging 0.96
R7672:Obsl1 UTSW 1 75492721 missense probably benign 0.18
R7715:Obsl1 UTSW 1 75502036 missense probably damaging 0.99
R8005:Obsl1 UTSW 1 75505452 missense probably damaging 1.00
R8012:Obsl1 UTSW 1 75492673 missense probably benign 0.12
V8831:Obsl1 UTSW 1 75486756 missense probably benign
X0061:Obsl1 UTSW 1 75486768 missense probably benign
Z1088:Obsl1 UTSW 1 75486756 missense probably benign
Z1176:Obsl1 UTSW 1 75486756 missense probably benign
Z1177:Obsl1 UTSW 1 75486756 missense probably benign
Z1177:Obsl1 UTSW 1 75491012 missense possibly damaging 0.95
Z1177:Obsl1 UTSW 1 75503792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTCACGCTCTCACATTTG -3'
(R):5'- ATGGCGTCTATCTGTGCGAG -3'

Sequencing Primer
(F):5'- CTCACATTTGACTCTGAGCAGGG -3'
(R):5'- ACTGTGGCCAATGTGACG -3'
Posted On2019-11-26