Incidental Mutation 'R7762:F2'
ID597911
Institutional Source Beutler Lab
Gene Symbol F2
Ensembl Gene ENSMUSG00000027249
Gene Namecoagulation factor II
SynonymsFII, Cf2, Cf-2, thrombin, prothrombin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91625320-91636414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91628696 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 476 (H476R)
Ref Sequence ENSEMBL: ENSMUSP00000028681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028681] [ENSMUST00000111335]
PDB Structure
Structural basis of Na+ activation mimicry in murine thrombin [X-RAY DIFFRACTION]
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR3 [X-RAY DIFFRACTION]
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR4 [X-RAY DIFFRACTION]
Crystal structure of the W215A/E217A mutant of murine thrombin [X-RAY DIFFRACTION]
Crystal structure of murine thrombin mutant W215A/E217A (one molecule in the asymmetric unit) [X-RAY DIFFRACTION]
Crystal structure of murine thrombin mutant W215A/E217A (two molecules in the asymmetric unit) [X-RAY DIFFRACTION]
Crystal structure of murine thrombin mutant W215A/E217A in complex with the extracellular fragment of human PAR1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028681
AA Change: H476R

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249
AA Change: H476R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111335
AA Change: H475R

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249
AA Change: H475R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in yolk sac vasculature, internal bleeding, tissue necrosis, and die in mid- to late-gestation, or rarely, a few days after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Ccr9 A T 9: 123,779,957 T235S probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clk2 G A 3: 89,167,191 V53I probably benign Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
Eral1 A G 11: 78,074,533 I352T possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Obsl1 A T 1: 75,503,523 C460S probably benign Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Orai3 G A 7: 127,773,571 G130S unknown Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmeff2 A T 1: 50,979,416 N186Y probably benign Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trpv1 G T 11: 73,254,222 K711N probably benign Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in F2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:F2 APN 2 91633094 missense probably benign 0.16
IGL02390:F2 APN 2 91632987 missense possibly damaging 0.81
IGL02859:F2 APN 2 91625742 missense probably damaging 1.00
IGL02970:F2 APN 2 91625551 missense possibly damaging 0.95
IGL03278:F2 APN 2 91635182 missense probably benign 0.01
Sarode UTSW 2 91635194 missense probably benign 0.35
R0007:F2 UTSW 2 91630607 missense probably benign 0.00
R0015:F2 UTSW 2 91630607 missense probably benign 0.00
R0137:F2 UTSW 2 91625730 missense probably damaging 1.00
R0211:F2 UTSW 2 91630158 missense probably damaging 1.00
R0304:F2 UTSW 2 91633233 missense probably damaging 0.99
R0601:F2 UTSW 2 91633311 splice site probably null
R0830:F2 UTSW 2 91630200 missense probably benign 0.34
R1693:F2 UTSW 2 91629179 missense probably damaging 1.00
R1720:F2 UTSW 2 91628830 nonsense probably null
R1763:F2 UTSW 2 91634906 missense probably damaging 1.00
R1865:F2 UTSW 2 91635194 missense probably benign 0.35
R1955:F2 UTSW 2 91633095 missense probably benign 0.01
R2055:F2 UTSW 2 91628442 missense probably benign 0.00
R2168:F2 UTSW 2 91628348 missense probably damaging 0.98
R2230:F2 UTSW 2 91625757 missense probably benign 0.01
R3916:F2 UTSW 2 91625488 missense probably damaging 1.00
R4004:F2 UTSW 2 91628396 missense possibly damaging 0.88
R4134:F2 UTSW 2 91629208 missense possibly damaging 0.93
R4298:F2 UTSW 2 91629320 critical splice acceptor site probably null
R4626:F2 UTSW 2 91630670 missense probably benign 0.07
R4902:F2 UTSW 2 91634971 intron probably benign
R5093:F2 UTSW 2 91634957 splice site probably benign
R5095:F2 UTSW 2 91634957 splice site probably benign
R5140:F2 UTSW 2 91634957 splice site probably benign
R5229:F2 UTSW 2 91630241 nonsense probably null
R5271:F2 UTSW 2 91635121 intron probably benign
R5335:F2 UTSW 2 91634932 missense possibly damaging 0.68
R7650:F2 UTSW 2 91628396 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTTTATAACCAGCCCGGAG -3'
(R):5'- AGCTGAGGATCTCATGAGTGG -3'

Sequencing Primer
(F):5'- GCCCGGAGCAAGCTTTAG -3'
(R):5'- AGGATCTCATGAGTGGTTCTTCTC -3'
Posted On2019-11-26