Incidental Mutation 'R7762:Clk2'
ID597916
Institutional Source Beutler Lab
Gene Symbol Clk2
Ensembl Gene ENSMUSG00000068917
Gene NameCDC-like kinase 2
Synonyms
Accession Numbers

Genbank: NM_007712, NM_001163432

Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89164795-89176921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89167191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 53 (V53I)
Ref Sequence ENSEMBL: ENSMUSP00000113390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090927] [ENSMUST00000121212] [ENSMUST00000121931] [ENSMUST00000128318] [ENSMUST00000148265] [ENSMUST00000152205]
Predicted Effect probably benign
Transcript: ENSMUST00000090927
AA Change: V53I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088445
Gene: ENSMUSG00000068917
AA Change: V53I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 105 137 N/A INTRINSIC
S_TKc 161 477 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121212
AA Change: V53I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113390
Gene: ENSMUSG00000068917
AA Change: V53I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
S_TKc 162 478 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121931
AA Change: V53I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113861
Gene: ENSMUSG00000068917
AA Change: V53I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 142 N/A INTRINSIC
S_TKc 163 479 1.46e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128318
AA Change: V53I

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115761
Gene: ENSMUSG00000068917
AA Change: V53I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 103 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148265
AA Change: V53I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122634
Gene: ENSMUSG00000068917
AA Change: V53I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
Pfam:Pkinase 162 249 7.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152205
AA Change: V53I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122202
Gene: ENSMUSG00000068917
AA Change: V53I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase that phosphorylates serine/threonine and tyrosine-containing substrates. Activity of this protein regulates serine- and arginine-rich (SR) proteins of the spliceosomal complex, thereby influencing alternative transcript splicing. Chromosomal translocations have been characterized between this locus and the PAFAH1B3 (platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)) gene on chromosome 19, resulting in the production of a fusion protein. Note that this gene is distinct from the TELO2 gene (GeneID:9894), which shares the CLK2 alias, but encodes a protein that is involved in telomere length regulation. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated in the liver exhibit decreased hepatic fatty acid oxidation and ketogenesis. [provided by MGI curators]
Allele List at MGI

 All alleles(12) : Targeted, other(1) Gene trapped(11)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Ccr9 A T 9: 123,779,957 T235S probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
Eral1 A G 11: 78,074,533 I352T possibly damaging Het
F2 T C 2: 91,628,696 H476R possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Obsl1 A T 1: 75,503,523 C460S probably benign Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Orai3 G A 7: 127,773,571 G130S unknown Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmeff2 A T 1: 50,979,416 N186Y probably benign Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trpv1 G T 11: 73,254,222 K711N probably benign Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in Clk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Clk2 APN 3 89175422 missense probably damaging 0.99
IGL01152:Clk2 APN 3 89176511 missense probably damaging 0.99
IGL02342:Clk2 APN 3 89175691 missense probably benign 0.00
IGL02387:Clk2 APN 3 89176391 unclassified probably benign
IGL02553:Clk2 APN 3 89175713 missense probably damaging 1.00
IGL02861:Clk2 APN 3 89173399 missense probably damaging 0.99
3-1:Clk2 UTSW 3 89170348 missense probably damaging 0.98
R1511:Clk2 UTSW 3 89168703 missense probably damaging 1.00
R1892:Clk2 UTSW 3 89175195 missense possibly damaging 0.48
R3796:Clk2 UTSW 3 89175689 missense probably benign
R3844:Clk2 UTSW 3 89170403 missense probably benign 0.06
R4737:Clk2 UTSW 3 89168709 missense probably benign 0.44
R5138:Clk2 UTSW 3 89175499 unclassified probably benign
R5413:Clk2 UTSW 3 89173478 missense probably benign 0.22
R5447:Clk2 UTSW 3 89167191 missense possibly damaging 0.92
R5538:Clk2 UTSW 3 89175655 missense probably damaging 0.99
R6128:Clk2 UTSW 3 89174224 missense probably damaging 1.00
R7346:Clk2 UTSW 3 89173545 critical splice donor site probably null
R7578:Clk2 UTSW 3 89176500 missense probably benign
R7894:Clk2 UTSW 3 89168894 missense possibly damaging 0.95
R7977:Clk2 UTSW 3 89168894 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAGGCATTCCACGAGAACG -3'
(R):5'- ACAATGCCTGGTGGGTACAG -3'

Sequencing Primer
(F):5'- CATTCCACGAGAACGGTTATG -3'
(R):5'- GTCTCATTATGTAGACCAGGCTGAC -3'
Posted On2019-11-26