Incidental Mutation 'R7762:Tmem132c'
ID 597927
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Name transmembrane protein 132C
Synonyms 2810482M11Rik, 4632425D07Rik
MMRRC Submission 045818-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7762 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 127318890-127642854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127631760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 673 (V673A)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000119026
AA Change: V673A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: V673A

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121783
Gene: ENSMUSG00000034324
AA Change: V55A

DomainStartEndE-ValueType
Pfam:TMEM132 1 112 6.2e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T G 14: 103,288,776 (GRCm39) D95E probably damaging Het
Agpat4 A G 17: 12,429,209 (GRCm39) T154A possibly damaging Het
Ahnak2 A T 12: 112,742,114 (GRCm39) S653T probably benign Het
Aoc1l2 G A 6: 48,909,620 (GRCm39) V622I probably benign Het
Aox1 C T 1: 58,388,263 (GRCm39) P1124S probably damaging Het
Armh3 A G 19: 45,928,882 (GRCm39) probably null Het
Atp4a T C 7: 30,419,461 (GRCm39) I637T probably damaging Het
Atxn7 T A 14: 14,100,467 (GRCm38) C718S probably damaging Het
Btbd2 T A 10: 80,479,390 (GRCm39) I516F probably damaging Het
Card6 A G 15: 5,134,820 (GRCm39) S128P probably benign Het
Cat T C 2: 103,287,203 (GRCm39) K476E probably benign Het
Ccr9 A T 9: 123,609,022 (GRCm39) T235S probably benign Het
Cep55 T G 19: 38,057,517 (GRCm39) probably null Het
Clec2e A G 6: 129,072,091 (GRCm39) F96S possibly damaging Het
Clk2 G A 3: 89,074,498 (GRCm39) V53I probably benign Het
Clnk T C 5: 38,925,484 (GRCm39) M106V probably benign Het
Col6a5 T C 9: 105,808,523 (GRCm39) I842V unknown Het
Csf1r A T 18: 61,243,572 (GRCm39) N196I probably benign Het
D5Ertd579e A T 5: 36,770,725 (GRCm39) N116K Het
Dnaja4 A G 9: 54,616,494 (GRCm39) I166V probably benign Het
Dqx1 A G 6: 83,038,013 (GRCm39) E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 (GRCm39) T1760A probably benign Het
Eea1 T C 10: 95,864,301 (GRCm39) V940A probably benign Het
Egr1 T A 18: 34,996,598 (GRCm39) V460E probably damaging Het
Eral1 A G 11: 77,965,359 (GRCm39) I352T possibly damaging Het
F2 T C 2: 91,459,041 (GRCm39) H476R possibly damaging Het
Fam83b A G 9: 76,399,714 (GRCm39) V463A possibly damaging Het
Fat1 T A 8: 45,490,374 (GRCm39) L3762H probably damaging Het
Fat1 T C 8: 45,476,359 (GRCm39) S1802P probably damaging Het
Fibp A T 19: 5,514,202 (GRCm39) N296Y probably benign Het
Figla A G 6: 85,994,308 (GRCm39) M28V probably benign Het
Foxd3 C A 4: 99,545,362 (GRCm39) Y167* probably null Het
Gm17019 T A 5: 15,081,006 (GRCm39) H145L probably benign Het
Gm48552 C T 10: 81,226,269 (GRCm39) P18L probably damaging Het
H2-Q6 A G 17: 35,647,077 (GRCm39) N283S probably benign Het
Hrh2 T A 13: 54,368,058 (GRCm39) C11* probably null Het
Hrnr G T 3: 93,239,506 (GRCm39) G3248V unknown Het
Iapp C A 6: 142,249,122 (GRCm39) N58K possibly damaging Het
Itga5 T C 15: 103,258,184 (GRCm39) N837S probably benign Het
Klhl35 C A 7: 99,117,647 (GRCm39) H64N probably benign Het
Lcor T C 19: 41,572,106 (GRCm39) L287S probably benign Het
Lrba T A 3: 86,439,508 (GRCm39) V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 (GRCm39) I3276T probably benign Het
Mlh3 G T 12: 85,315,058 (GRCm39) T376K possibly damaging Het
Muc21 G A 17: 35,932,977 (GRCm39) T403I unknown Het
Nbea A T 3: 55,557,126 (GRCm39) H2550Q probably damaging Het
Nid1 G A 13: 13,663,630 (GRCm39) G763D probably damaging Het
Ntf5 C A 7: 45,065,243 (GRCm39) A125E probably damaging Het
Obsl1 A T 1: 75,480,167 (GRCm39) C460S probably benign Het
Or1j19 A T 2: 36,677,022 (GRCm39) I162F probably benign Het
Or1s2 A T 19: 13,758,650 (GRCm39) R223W probably damaging Het
Or2g7 G A 17: 38,378,566 (GRCm39) C168Y probably damaging Het
Or2y10 T A 11: 49,455,588 (GRCm39) I280N possibly damaging Het
Or4b1b T A 2: 90,126,975 (GRCm39) K77* probably null Het
Or6c33 A G 10: 129,853,050 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Orai3 G A 7: 127,372,743 (GRCm39) G130S unknown Het
Pcdhb12 T G 18: 37,568,977 (GRCm39) V41G probably damaging Het
Plec A T 15: 76,067,823 (GRCm39) L1194Q unknown Het
Pml C A 9: 58,127,456 (GRCm39) C763F probably damaging Het
Prdm15 T A 16: 97,619,473 (GRCm39) I318F probably benign Het
Rcbtb2 C A 14: 73,415,906 (GRCm39) T473N probably benign Het
Sbno1 T A 5: 124,512,729 (GRCm39) I1347F probably benign Het
Secisbp2l C T 2: 125,610,113 (GRCm39) D269N probably damaging Het
Serpina9 A T 12: 103,967,575 (GRCm39) F273L probably damaging Het
Sgms2 T A 3: 131,116,898 (GRCm39) Y319F probably benign Het
Sgo2b A T 8: 64,379,531 (GRCm39) H1100Q probably benign Het
Sh3bp5l A T 11: 58,236,754 (GRCm39) probably null Het
Shh T G 5: 28,671,664 (GRCm39) K33T probably benign Het
Slc5a9 A G 4: 111,747,371 (GRCm39) Y339H probably damaging Het
Spice1 T A 16: 44,190,864 (GRCm39) probably null Het
Tbx2 A G 11: 85,726,727 (GRCm39) E257G probably damaging Het
Tenm2 G A 11: 35,914,133 (GRCm39) T2468I possibly damaging Het
Tmeff2 A T 1: 51,018,575 (GRCm39) N186Y probably benign Het
Trappc11 G T 8: 47,975,411 (GRCm39) T269K probably damaging Het
Trpc6 T C 9: 8,653,150 (GRCm39) F652S possibly damaging Het
Trpv1 G T 11: 73,145,048 (GRCm39) K711N probably benign Het
Vcan G T 13: 89,841,056 (GRCm39) P1496Q probably damaging Het
Vmn1r192 G T 13: 22,371,845 (GRCm39) A125E probably damaging Het
Vti1b A T 12: 79,211,720 (GRCm39) probably null Het
Vwa3b A C 1: 37,163,126 (GRCm39) D583A probably damaging Het
Zfp638 T C 6: 83,953,254 (GRCm39) S1120P probably damaging Het
Zfyve26 A T 12: 79,315,409 (GRCm39) F1356I probably benign Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127,640,306 (GRCm39) missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127,581,930 (GRCm39) missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127,436,616 (GRCm39) splice site probably benign
IGL01750:Tmem132c APN 5 127,540,023 (GRCm39) missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127,540,093 (GRCm39) missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127,640,466 (GRCm39) missense probably benign 0.03
IGL02164:Tmem132c APN 5 127,613,441 (GRCm39) missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127,539,991 (GRCm39) missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127,436,675 (GRCm39) missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127,582,063 (GRCm39) missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127,640,154 (GRCm39) missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127,640,688 (GRCm39) missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127,640,448 (GRCm39) missense probably benign 0.06
IGL03380:Tmem132c APN 5 127,613,506 (GRCm39) missense probably benign 0.00
IGL03387:Tmem132c APN 5 127,640,784 (GRCm39) missense probably benign 0.00
R0106:Tmem132c UTSW 5 127,631,733 (GRCm39) missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127,631,733 (GRCm39) missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127,640,769 (GRCm39) missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127,640,617 (GRCm39) nonsense probably null
R1413:Tmem132c UTSW 5 127,640,631 (GRCm39) missense probably damaging 1.00
R1531:Tmem132c UTSW 5 127,436,955 (GRCm39) missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127,540,120 (GRCm39) splice site probably benign
R2148:Tmem132c UTSW 5 127,540,026 (GRCm39) missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127,540,026 (GRCm39) missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127,581,988 (GRCm39) missense probably benign 0.01
R3853:Tmem132c UTSW 5 127,436,933 (GRCm39) missense probably benign 0.00
R4204:Tmem132c UTSW 5 127,640,829 (GRCm39) missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127,582,041 (GRCm39) missense probably benign 0.00
R4701:Tmem132c UTSW 5 127,641,560 (GRCm39) unclassified probably benign
R5017:Tmem132c UTSW 5 127,640,414 (GRCm39) missense probably benign 0.13
R5037:Tmem132c UTSW 5 127,630,199 (GRCm39) missense probably benign 0.42
R5327:Tmem132c UTSW 5 127,640,816 (GRCm39) missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127,640,907 (GRCm39) missense probably benign 0.02
R5548:Tmem132c UTSW 5 127,628,587 (GRCm39) nonsense probably null
R6425:Tmem132c UTSW 5 127,630,329 (GRCm39) missense possibly damaging 0.95
R6717:Tmem132c UTSW 5 127,641,093 (GRCm39) missense possibly damaging 0.93
R6899:Tmem132c UTSW 5 127,628,744 (GRCm39) missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127,436,679 (GRCm39) missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127,437,281 (GRCm39) missense probably benign 0.06
R7326:Tmem132c UTSW 5 127,641,123 (GRCm39) missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127,640,990 (GRCm39) missense probably benign 0.16
R7504:Tmem132c UTSW 5 127,631,696 (GRCm39) missense probably damaging 1.00
R7640:Tmem132c UTSW 5 127,640,070 (GRCm39) missense probably damaging 1.00
R7718:Tmem132c UTSW 5 127,640,504 (GRCm39) missense probably benign 0.06
R7818:Tmem132c UTSW 5 127,641,152 (GRCm39) makesense probably null
R8117:Tmem132c UTSW 5 127,437,176 (GRCm39) missense probably benign 0.22
R8425:Tmem132c UTSW 5 127,641,421 (GRCm39) missense
R8749:Tmem132c UTSW 5 127,437,003 (GRCm39) missense possibly damaging 0.75
R8771:Tmem132c UTSW 5 127,437,192 (GRCm39) missense probably benign 0.00
R8798:Tmem132c UTSW 5 127,437,217 (GRCm39) nonsense probably null
R9372:Tmem132c UTSW 5 127,640,145 (GRCm39) missense probably damaging 1.00
X0067:Tmem132c UTSW 5 127,613,471 (GRCm39) missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127,581,985 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGTTCAGGACTTCTGGCCTATC -3'
(R):5'- TTCTGTGTGACCTGAGCACTTG -3'

Sequencing Primer
(F):5'- CAGGACTTCTGGCCTATCTAGGG -3'
(R):5'- GTAGCTCCTGTAACCCTGAAC -3'
Posted On 2019-11-26