Incidental Mutation 'R7762:Atp4a'
ID 597934
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene Name ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms H+K+-transporting alpha 1, H+/K+-ATPase alpha
MMRRC Submission 045818-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7762 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30411634-30424959 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30419461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 637 (I637T)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005692
AA Change: I637T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: I637T

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170371
AA Change: I637T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: I637T

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T G 14: 103,288,776 (GRCm39) D95E probably damaging Het
Agpat4 A G 17: 12,429,209 (GRCm39) T154A possibly damaging Het
Ahnak2 A T 12: 112,742,114 (GRCm39) S653T probably benign Het
Aoc1l2 G A 6: 48,909,620 (GRCm39) V622I probably benign Het
Aox1 C T 1: 58,388,263 (GRCm39) P1124S probably damaging Het
Armh3 A G 19: 45,928,882 (GRCm39) probably null Het
Atxn7 T A 14: 14,100,467 (GRCm38) C718S probably damaging Het
Btbd2 T A 10: 80,479,390 (GRCm39) I516F probably damaging Het
Card6 A G 15: 5,134,820 (GRCm39) S128P probably benign Het
Cat T C 2: 103,287,203 (GRCm39) K476E probably benign Het
Ccr9 A T 9: 123,609,022 (GRCm39) T235S probably benign Het
Cep55 T G 19: 38,057,517 (GRCm39) probably null Het
Clec2e A G 6: 129,072,091 (GRCm39) F96S possibly damaging Het
Clk2 G A 3: 89,074,498 (GRCm39) V53I probably benign Het
Clnk T C 5: 38,925,484 (GRCm39) M106V probably benign Het
Col6a5 T C 9: 105,808,523 (GRCm39) I842V unknown Het
Csf1r A T 18: 61,243,572 (GRCm39) N196I probably benign Het
D5Ertd579e A T 5: 36,770,725 (GRCm39) N116K Het
Dnaja4 A G 9: 54,616,494 (GRCm39) I166V probably benign Het
Dqx1 A G 6: 83,038,013 (GRCm39) E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 (GRCm39) T1760A probably benign Het
Eea1 T C 10: 95,864,301 (GRCm39) V940A probably benign Het
Egr1 T A 18: 34,996,598 (GRCm39) V460E probably damaging Het
Eral1 A G 11: 77,965,359 (GRCm39) I352T possibly damaging Het
F2 T C 2: 91,459,041 (GRCm39) H476R possibly damaging Het
Fam83b A G 9: 76,399,714 (GRCm39) V463A possibly damaging Het
Fat1 T A 8: 45,490,374 (GRCm39) L3762H probably damaging Het
Fat1 T C 8: 45,476,359 (GRCm39) S1802P probably damaging Het
Fibp A T 19: 5,514,202 (GRCm39) N296Y probably benign Het
Figla A G 6: 85,994,308 (GRCm39) M28V probably benign Het
Foxd3 C A 4: 99,545,362 (GRCm39) Y167* probably null Het
Gm17019 T A 5: 15,081,006 (GRCm39) H145L probably benign Het
Gm48552 C T 10: 81,226,269 (GRCm39) P18L probably damaging Het
H2-Q6 A G 17: 35,647,077 (GRCm39) N283S probably benign Het
Hrh2 T A 13: 54,368,058 (GRCm39) C11* probably null Het
Hrnr G T 3: 93,239,506 (GRCm39) G3248V unknown Het
Iapp C A 6: 142,249,122 (GRCm39) N58K possibly damaging Het
Itga5 T C 15: 103,258,184 (GRCm39) N837S probably benign Het
Klhl35 C A 7: 99,117,647 (GRCm39) H64N probably benign Het
Lcor T C 19: 41,572,106 (GRCm39) L287S probably benign Het
Lrba T A 3: 86,439,508 (GRCm39) V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 (GRCm39) I3276T probably benign Het
Mlh3 G T 12: 85,315,058 (GRCm39) T376K possibly damaging Het
Muc21 G A 17: 35,932,977 (GRCm39) T403I unknown Het
Nbea A T 3: 55,557,126 (GRCm39) H2550Q probably damaging Het
Nid1 G A 13: 13,663,630 (GRCm39) G763D probably damaging Het
Ntf5 C A 7: 45,065,243 (GRCm39) A125E probably damaging Het
Obsl1 A T 1: 75,480,167 (GRCm39) C460S probably benign Het
Or1j19 A T 2: 36,677,022 (GRCm39) I162F probably benign Het
Or1s2 A T 19: 13,758,650 (GRCm39) R223W probably damaging Het
Or2g7 G A 17: 38,378,566 (GRCm39) C168Y probably damaging Het
Or2y10 T A 11: 49,455,588 (GRCm39) I280N possibly damaging Het
Or4b1b T A 2: 90,126,975 (GRCm39) K77* probably null Het
Or6c33 A G 10: 129,853,050 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Orai3 G A 7: 127,372,743 (GRCm39) G130S unknown Het
Pcdhb12 T G 18: 37,568,977 (GRCm39) V41G probably damaging Het
Plec A T 15: 76,067,823 (GRCm39) L1194Q unknown Het
Pml C A 9: 58,127,456 (GRCm39) C763F probably damaging Het
Prdm15 T A 16: 97,619,473 (GRCm39) I318F probably benign Het
Rcbtb2 C A 14: 73,415,906 (GRCm39) T473N probably benign Het
Sbno1 T A 5: 124,512,729 (GRCm39) I1347F probably benign Het
Secisbp2l C T 2: 125,610,113 (GRCm39) D269N probably damaging Het
Serpina9 A T 12: 103,967,575 (GRCm39) F273L probably damaging Het
Sgms2 T A 3: 131,116,898 (GRCm39) Y319F probably benign Het
Sgo2b A T 8: 64,379,531 (GRCm39) H1100Q probably benign Het
Sh3bp5l A T 11: 58,236,754 (GRCm39) probably null Het
Shh T G 5: 28,671,664 (GRCm39) K33T probably benign Het
Slc5a9 A G 4: 111,747,371 (GRCm39) Y339H probably damaging Het
Spice1 T A 16: 44,190,864 (GRCm39) probably null Het
Tbx2 A G 11: 85,726,727 (GRCm39) E257G probably damaging Het
Tenm2 G A 11: 35,914,133 (GRCm39) T2468I possibly damaging Het
Tmeff2 A T 1: 51,018,575 (GRCm39) N186Y probably benign Het
Tmem132c T C 5: 127,631,760 (GRCm39) V673A possibly damaging Het
Trappc11 G T 8: 47,975,411 (GRCm39) T269K probably damaging Het
Trpc6 T C 9: 8,653,150 (GRCm39) F652S possibly damaging Het
Trpv1 G T 11: 73,145,048 (GRCm39) K711N probably benign Het
Vcan G T 13: 89,841,056 (GRCm39) P1496Q probably damaging Het
Vmn1r192 G T 13: 22,371,845 (GRCm39) A125E probably damaging Het
Vti1b A T 12: 79,211,720 (GRCm39) probably null Het
Vwa3b A C 1: 37,163,126 (GRCm39) D583A probably damaging Het
Zfp638 T C 6: 83,953,254 (GRCm39) S1120P probably damaging Het
Zfyve26 A T 12: 79,315,409 (GRCm39) F1356I probably benign Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30,412,629 (GRCm39) missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30,412,675 (GRCm39) missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30,420,216 (GRCm39) missense probably benign 0.02
IGL01763:Atp4a APN 7 30,414,943 (GRCm39) missense probably benign 0.20
IGL02061:Atp4a APN 7 30,414,454 (GRCm39) missense probably damaging 1.00
IGL02435:Atp4a APN 7 30,416,482 (GRCm39) missense probably benign
IGL02903:Atp4a APN 7 30,415,344 (GRCm39) missense probably benign 0.00
IGL03181:Atp4a APN 7 30,424,129 (GRCm39) missense probably benign 0.02
IGL03350:Atp4a APN 7 30,420,292 (GRCm39) missense probably damaging 1.00
atypical UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
sublytic UTSW 7 30,415,225 (GRCm39) missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30,422,462 (GRCm39) missense probably benign 0.14
R0095:Atp4a UTSW 7 30,420,160 (GRCm39) missense probably damaging 0.99
R0121:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0140:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0241:Atp4a UTSW 7 30,416,560 (GRCm39) missense probably benign 0.00
R0437:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0624:Atp4a UTSW 7 30,418,424 (GRCm39) missense probably benign
R1164:Atp4a UTSW 7 30,417,117 (GRCm39) missense probably benign 0.00
R2105:Atp4a UTSW 7 30,419,793 (GRCm39) critical splice donor site probably null
R2272:Atp4a UTSW 7 30,414,925 (GRCm39) nonsense probably null
R2327:Atp4a UTSW 7 30,419,666 (GRCm39) missense probably benign 0.16
R2881:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2990:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2992:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2993:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3123:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3125:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3441:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3442:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3686:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3687:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3845:Atp4a UTSW 7 30,416,540 (GRCm39) missense probably null 0.99
R4027:Atp4a UTSW 7 30,424,377 (GRCm39) splice site probably null
R4072:Atp4a UTSW 7 30,414,757 (GRCm39) missense probably benign 0.09
R4433:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4454:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4457:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4458:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4510:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4511:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4576:Atp4a UTSW 7 30,417,147 (GRCm39) missense probably benign 0.25
R4656:Atp4a UTSW 7 30,419,373 (GRCm39) intron probably benign
R4661:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4662:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4852:Atp4a UTSW 7 30,423,693 (GRCm39) missense probably benign 0.10
R4892:Atp4a UTSW 7 30,411,899 (GRCm39) missense probably benign 0.07
R4907:Atp4a UTSW 7 30,418,517 (GRCm39) missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30,415,289 (GRCm39) missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30,414,955 (GRCm39) missense probably damaging 1.00
R5318:Atp4a UTSW 7 30,414,754 (GRCm39) missense probably damaging 1.00
R5340:Atp4a UTSW 7 30,420,231 (GRCm39) missense probably benign
R5484:Atp4a UTSW 7 30,420,097 (GRCm39) unclassified probably benign
R5729:Atp4a UTSW 7 30,411,851 (GRCm39) missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30,418,521 (GRCm39) missense probably damaging 0.99
R5797:Atp4a UTSW 7 30,412,074 (GRCm39) missense probably damaging 1.00
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6077:Atp4a UTSW 7 30,415,344 (GRCm39) missense probably benign 0.00
R6243:Atp4a UTSW 7 30,415,382 (GRCm39) missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30,411,887 (GRCm39) missense probably benign 0.00
R6515:Atp4a UTSW 7 30,411,903 (GRCm39) missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30,414,802 (GRCm39) missense probably damaging 0.98
R6854:Atp4a UTSW 7 30,414,433 (GRCm39) missense probably benign 0.29
R7215:Atp4a UTSW 7 30,416,785 (GRCm39) missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30,421,944 (GRCm39) missense probably benign 0.16
R7340:Atp4a UTSW 7 30,416,155 (GRCm39) missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30,420,192 (GRCm39) missense probably benign 0.08
R7593:Atp4a UTSW 7 30,424,105 (GRCm39) missense probably benign 0.08
R7712:Atp4a UTSW 7 30,414,978 (GRCm39) missense probably damaging 0.96
R8714:Atp4a UTSW 7 30,420,013 (GRCm39) missense probably damaging 0.99
R9324:Atp4a UTSW 7 30,415,207 (GRCm39) missense probably benign 0.02
Z1177:Atp4a UTSW 7 30,417,265 (GRCm39) missense possibly damaging 0.47
Z1186:Atp4a UTSW 7 30,416,782 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACTAAGCTGTCTACCTGG -3'
(R):5'- TACCATTGATCACGCAGGCC -3'

Sequencing Primer
(F):5'- GCACTGTATCTTTAGCAAGTCAGGC -3'
(R):5'- TATTAACCTGGTCCACCG -3'
Posted On 2019-11-26