Incidental Mutation 'R7762:Orai3'
ID597937
Institutional Source Beutler Lab
Gene Symbol Orai3
Ensembl Gene ENSMUSG00000043964
Gene NameORAI calcium release-activated calcium modulator 3
SynonymsTmem142c
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127769815-127775150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127773571 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 130 (G130S)
Ref Sequence ENSEMBL: ENSMUSP00000113142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033081] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000061587] [ENSMUST00000118865] [ENSMUST00000121504] [ENSMUST00000126761] [ENSMUST00000143951] [ENSMUST00000144406] [ENSMUST00000186116] [ENSMUST00000186207] [ENSMUST00000188580] [ENSMUST00000206893]
Predicted Effect probably benign
Transcript: ENSMUST00000033081
SMART Domains Protein: ENSMUSP00000033081
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect silent
Transcript: ENSMUST00000061587
SMART Domains Protein: ENSMUSP00000050279
Gene: ENSMUSG00000043964

DomainStartEndE-ValueType
Pfam:Orai-1 46 271 1.3e-70 PFAM
Predicted Effect silent
Transcript: ENSMUST00000118865
SMART Domains Protein: ENSMUSP00000112382
Gene: ENSMUSG00000043964

DomainStartEndE-ValueType
Pfam:Orai-1 42 165 1.5e-62 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000121504
AA Change: G130S
SMART Domains Protein: ENSMUSP00000113142
Gene: ENSMUSG00000043964
AA Change: G130S

DomainStartEndE-ValueType
Pfam:Orai-1 42 94 1.3e-16 PFAM
low complexity region 125 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143951
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186116
SMART Domains Protein: ENSMUSP00000140083
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 63 85 N/A INTRINSIC
FBOX 112 152 3e-6 SMART
low complexity region 217 228 N/A INTRINSIC
LRR 284 309 1.5e-1 SMART
LRR 339 364 5.3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186207
SMART Domains Protein: ENSMUSP00000140303
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188580
SMART Domains Protein: ENSMUSP00000140021
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.3e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 186 209 N/A INTRINSIC
low complexity region 239 261 N/A INTRINSIC
FBOX 288 328 4.6e-4 SMART
low complexity region 393 404 N/A INTRINSIC
LRR 460 485 3.58e1 SMART
LRR 515 540 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206893
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Ccr9 A T 9: 123,779,957 T235S probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clk2 G A 3: 89,167,191 V53I probably benign Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
Eral1 A G 11: 78,074,533 I352T possibly damaging Het
F2 T C 2: 91,628,696 H476R possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Obsl1 A T 1: 75,503,523 C460S probably benign Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmeff2 A T 1: 50,979,416 N186Y probably benign Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trpv1 G T 11: 73,254,222 K711N probably benign Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in Orai3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02378:Orai3 APN 7 127770161 missense probably damaging 1.00
IGL03105:Orai3 APN 7 127773553 unclassified probably benign
R1493:Orai3 UTSW 7 127773905 missense possibly damaging 0.69
R4795:Orai3 UTSW 7 127773888 missense probably benign 0.03
R4973:Orai3 UTSW 7 127774176 missense probably damaging 1.00
R6053:Orai3 UTSW 7 127773878 missense probably benign 0.00
R6684:Orai3 UTSW 7 127773720 missense probably damaging 1.00
R7490:Orai3 UTSW 7 127773627 missense possibly damaging 0.53
R7651:Orai3 UTSW 7 127774064 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGCCCCTTTGAGACTGAGG -3'
(R):5'- ACGTATCTGTGCAGTCGTTG -3'

Sequencing Primer
(F):5'- CCCTTTGAGACTGAGGTGAAGTCAC -3'
(R):5'- CAGTCGTTGGTGTGGTGAC -3'
Posted On2019-11-26