Incidental Mutation 'R7762:Fam83b'
ID 597947
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission 045818-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7762 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76399714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 463 (V463A)
Ref Sequence ENSEMBL: ENSMUSP00000096146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect possibly damaging
Transcript: ENSMUST00000098546
AA Change: V463A

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: V463A

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183437
AA Change: V463A

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: V463A

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T G 14: 103,288,776 (GRCm39) D95E probably damaging Het
Agpat4 A G 17: 12,429,209 (GRCm39) T154A possibly damaging Het
Ahnak2 A T 12: 112,742,114 (GRCm39) S653T probably benign Het
Aoc1l2 G A 6: 48,909,620 (GRCm39) V622I probably benign Het
Aox1 C T 1: 58,388,263 (GRCm39) P1124S probably damaging Het
Armh3 A G 19: 45,928,882 (GRCm39) probably null Het
Atp4a T C 7: 30,419,461 (GRCm39) I637T probably damaging Het
Atxn7 T A 14: 14,100,467 (GRCm38) C718S probably damaging Het
Btbd2 T A 10: 80,479,390 (GRCm39) I516F probably damaging Het
Card6 A G 15: 5,134,820 (GRCm39) S128P probably benign Het
Cat T C 2: 103,287,203 (GRCm39) K476E probably benign Het
Ccr9 A T 9: 123,609,022 (GRCm39) T235S probably benign Het
Cep55 T G 19: 38,057,517 (GRCm39) probably null Het
Clec2e A G 6: 129,072,091 (GRCm39) F96S possibly damaging Het
Clk2 G A 3: 89,074,498 (GRCm39) V53I probably benign Het
Clnk T C 5: 38,925,484 (GRCm39) M106V probably benign Het
Col6a5 T C 9: 105,808,523 (GRCm39) I842V unknown Het
Csf1r A T 18: 61,243,572 (GRCm39) N196I probably benign Het
D5Ertd579e A T 5: 36,770,725 (GRCm39) N116K Het
Dnaja4 A G 9: 54,616,494 (GRCm39) I166V probably benign Het
Dqx1 A G 6: 83,038,013 (GRCm39) E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 (GRCm39) T1760A probably benign Het
Eea1 T C 10: 95,864,301 (GRCm39) V940A probably benign Het
Egr1 T A 18: 34,996,598 (GRCm39) V460E probably damaging Het
Eral1 A G 11: 77,965,359 (GRCm39) I352T possibly damaging Het
F2 T C 2: 91,459,041 (GRCm39) H476R possibly damaging Het
Fat1 T A 8: 45,490,374 (GRCm39) L3762H probably damaging Het
Fat1 T C 8: 45,476,359 (GRCm39) S1802P probably damaging Het
Fibp A T 19: 5,514,202 (GRCm39) N296Y probably benign Het
Figla A G 6: 85,994,308 (GRCm39) M28V probably benign Het
Foxd3 C A 4: 99,545,362 (GRCm39) Y167* probably null Het
Gm17019 T A 5: 15,081,006 (GRCm39) H145L probably benign Het
Gm48552 C T 10: 81,226,269 (GRCm39) P18L probably damaging Het
H2-Q6 A G 17: 35,647,077 (GRCm39) N283S probably benign Het
Hrh2 T A 13: 54,368,058 (GRCm39) C11* probably null Het
Hrnr G T 3: 93,239,506 (GRCm39) G3248V unknown Het
Iapp C A 6: 142,249,122 (GRCm39) N58K possibly damaging Het
Itga5 T C 15: 103,258,184 (GRCm39) N837S probably benign Het
Klhl35 C A 7: 99,117,647 (GRCm39) H64N probably benign Het
Lcor T C 19: 41,572,106 (GRCm39) L287S probably benign Het
Lrba T A 3: 86,439,508 (GRCm39) V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 (GRCm39) I3276T probably benign Het
Mlh3 G T 12: 85,315,058 (GRCm39) T376K possibly damaging Het
Muc21 G A 17: 35,932,977 (GRCm39) T403I unknown Het
Nbea A T 3: 55,557,126 (GRCm39) H2550Q probably damaging Het
Nid1 G A 13: 13,663,630 (GRCm39) G763D probably damaging Het
Ntf5 C A 7: 45,065,243 (GRCm39) A125E probably damaging Het
Obsl1 A T 1: 75,480,167 (GRCm39) C460S probably benign Het
Or1j19 A T 2: 36,677,022 (GRCm39) I162F probably benign Het
Or1s2 A T 19: 13,758,650 (GRCm39) R223W probably damaging Het
Or2g7 G A 17: 38,378,566 (GRCm39) C168Y probably damaging Het
Or2y10 T A 11: 49,455,588 (GRCm39) I280N possibly damaging Het
Or4b1b T A 2: 90,126,975 (GRCm39) K77* probably null Het
Or6c33 A G 10: 129,853,050 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Orai3 G A 7: 127,372,743 (GRCm39) G130S unknown Het
Pcdhb12 T G 18: 37,568,977 (GRCm39) V41G probably damaging Het
Plec A T 15: 76,067,823 (GRCm39) L1194Q unknown Het
Pml C A 9: 58,127,456 (GRCm39) C763F probably damaging Het
Prdm15 T A 16: 97,619,473 (GRCm39) I318F probably benign Het
Rcbtb2 C A 14: 73,415,906 (GRCm39) T473N probably benign Het
Sbno1 T A 5: 124,512,729 (GRCm39) I1347F probably benign Het
Secisbp2l C T 2: 125,610,113 (GRCm39) D269N probably damaging Het
Serpina9 A T 12: 103,967,575 (GRCm39) F273L probably damaging Het
Sgms2 T A 3: 131,116,898 (GRCm39) Y319F probably benign Het
Sgo2b A T 8: 64,379,531 (GRCm39) H1100Q probably benign Het
Sh3bp5l A T 11: 58,236,754 (GRCm39) probably null Het
Shh T G 5: 28,671,664 (GRCm39) K33T probably benign Het
Slc5a9 A G 4: 111,747,371 (GRCm39) Y339H probably damaging Het
Spice1 T A 16: 44,190,864 (GRCm39) probably null Het
Tbx2 A G 11: 85,726,727 (GRCm39) E257G probably damaging Het
Tenm2 G A 11: 35,914,133 (GRCm39) T2468I possibly damaging Het
Tmeff2 A T 1: 51,018,575 (GRCm39) N186Y probably benign Het
Tmem132c T C 5: 127,631,760 (GRCm39) V673A possibly damaging Het
Trappc11 G T 8: 47,975,411 (GRCm39) T269K probably damaging Het
Trpc6 T C 9: 8,653,150 (GRCm39) F652S possibly damaging Het
Trpv1 G T 11: 73,145,048 (GRCm39) K711N probably benign Het
Vcan G T 13: 89,841,056 (GRCm39) P1496Q probably damaging Het
Vmn1r192 G T 13: 22,371,845 (GRCm39) A125E probably damaging Het
Vti1b A T 12: 79,211,720 (GRCm39) probably null Het
Vwa3b A C 1: 37,163,126 (GRCm39) D583A probably damaging Het
Zfp638 T C 6: 83,953,254 (GRCm39) S1120P probably damaging Het
Zfyve26 A T 12: 79,315,409 (GRCm39) F1356I probably benign Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76,399,594 (GRCm39) missense probably damaging 1.00
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1939:Fam83b UTSW 9 76,400,362 (GRCm39) missense probably damaging 1.00
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5488:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6468:Fam83b UTSW 9 76,409,413 (GRCm39) nonsense probably null
R6912:Fam83b UTSW 9 76,398,214 (GRCm39) missense probably damaging 0.99
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8067:Fam83b UTSW 9 76,398,380 (GRCm39) missense probably benign
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9656:Fam83b UTSW 9 76,452,863 (GRCm39) missense probably benign 0.02
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGAGTGCATTGGCTTTCACG -3'
(R):5'- CAACAGAGCTATGAATCGGACC -3'

Sequencing Primer
(F):5'- AGGGTTTTCGTAGCCTTCAAATC -3'
(R):5'- TGAATCGGACCAATAATGCTCCTGG -3'
Posted On 2019-11-26