Incidental Mutation 'R7762:Ccr9'
ID597949
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Namechemokine (C-C motif) receptor 9
SynonymsCmkbr10, GPR-9-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123678439-123784330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123779957 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 235 (T235S)
Ref Sequence ENSEMBL: ENSMUSP00000131782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
Predicted Effect probably benign
Transcript: ENSMUST00000111454
AA Change: T223S

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: T223S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163559
AA Change: T235S

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: T235S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166236
AA Change: T235S

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: T235S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168910
AA Change: T235S

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: T235S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180093
AA Change: T235S

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: T235S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clk2 G A 3: 89,167,191 V53I probably benign Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
Eral1 A G 11: 78,074,533 I352T possibly damaging Het
F2 T C 2: 91,628,696 H476R possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Obsl1 A T 1: 75,503,523 C460S probably benign Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Orai3 G A 7: 127,773,571 G130S unknown Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmeff2 A T 1: 50,979,416 N186Y probably benign Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trpv1 G T 11: 73,254,222 K711N probably benign Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123780044 missense probably benign 0.00
IGL00983:Ccr9 APN 9 123779286 missense probably benign
IGL02466:Ccr9 APN 9 123779846 missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123774573 utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123779536 missense probably damaging 1.00
hamlet UTSW 9 123779439 missense probably damaging 1.00
Laertes UTSW 9 123779846 missense probably damaging 1.00
Ophelia UTSW 9 123779469 missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123774552 utr 5 prime probably benign
R0393:Ccr9 UTSW 9 123779970 missense probably benign 0.18
R0421:Ccr9 UTSW 9 123779606 missense probably benign
R2069:Ccr9 UTSW 9 123779364 missense probably benign 0.05
R3980:Ccr9 UTSW 9 123779376 missense probably benign 0.14
R4645:Ccr9 UTSW 9 123779593 missense probably benign 0.00
R4672:Ccr9 UTSW 9 123779687 missense probably damaging 0.96
R4920:Ccr9 UTSW 9 123779439 missense probably damaging 1.00
R5661:Ccr9 UTSW 9 123780099 missense probably benign 0.04
R5964:Ccr9 UTSW 9 123779434 missense probably benign 0.12
R7037:Ccr9 UTSW 9 123779971 missense possibly damaging 0.52
R7500:Ccr9 UTSW 9 123779469 missense probably damaging 1.00
R7620:Ccr9 UTSW 9 123779846 missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123779306 missense probably damaging 0.98
R8154:Ccr9 UTSW 9 123779831 missense probably benign 0.00
R8283:Ccr9 UTSW 9 123779631 missense probably damaging 1.00
R8525:Ccr9 UTSW 9 123779667 missense probably benign 0.31
X0026:Ccr9 UTSW 9 123779501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTGCATTACCATCTGG -3'
(R):5'- CTGGAAGCAGATGTCAATATTGGTG -3'

Sequencing Primer
(F):5'- CATCTGGGTGATGGCAGC -3'
(R):5'- TGTCAATATTGGTGGAAATAGTGCAG -3'
Posted On2019-11-26