Incidental Mutation 'R7762:Trpv1'
ID597957
Institutional Source Beutler Lab
Gene Symbol Trpv1
Ensembl Gene ENSMUSG00000005952
Gene Nametransient receptor potential cation channel, subfamily V, member 1
SynonymsOTRPC1, VR-1, capsaicin receptor, Vr1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73234292-73261242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73254222 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 711 (K711N)
Ref Sequence ENSEMBL: ENSMUSP00000099585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006106] [ENSMUST00000102526] [ENSMUST00000108470] [ENSMUST00000138853]
Predicted Effect probably benign
Transcript: ENSMUST00000006106
AA Change: K651N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000006106
Gene: ENSMUSG00000005952
AA Change: K651N

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 4e-8 BLAST
Blast:ANK 334 370 6e-9 BLAST
PDB:3J5R|D 339 660 N/A PDB
Blast:PHB 658 704 1e-8 BLAST
PDB:3SUI|B 708 742 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000102526
AA Change: K711N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099585
Gene: ENSMUSG00000005952
AA Change: K711N

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 5e-8 BLAST
ANK 333 363 6.17e-1 SMART
Pfam:Ion_trans 432 695 3e-12 PFAM
Blast:PHB 718 764 1e-8 BLAST
PDB:3SUI|B 768 802 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108470
AA Change: K343N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104110
Gene: ENSMUSG00000005952
AA Change: K343N

DomainStartEndE-ValueType
Blast:ANK 26 62 4e-9 BLAST
Pfam:Ion_trans 111 315 1.8e-8 PFAM
Blast:PHB 350 396 6e-9 BLAST
PDB:3SUI|B 400 434 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138853
AA Change: K403N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116400
Gene: ENSMUSG00000005952
AA Change: K403N

DomainStartEndE-ValueType
ANK 25 55 6.17e-1 SMART
Pfam:Ion_trans 171 375 1.8e-8 PFAM
Blast:PHB 410 456 6e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Capsaicin, the main pungent ingredient in hot chili peppers, elicits a sensation of burning pain by selectively activating sensory neurons that convey information about noxious stimuli to the central nervous system. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel that is structurally related to members of the TRP family of ion channels. This receptor is also activated by increases in temperature in the noxious range, suggesting that it functions as a transducer of painful thermal stimuli in vivo. Four transcript variants encoding the same protein, but with different 5' UTR sequence, have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal nociception, abnormal anxiety- and conditioning-related behaviors, increased sensitivity to DOCA-salt-induced renal damage, resistance to diet-induced obesity, altered taste sensitivity, and impaired febrile response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Ccr9 A T 9: 123,779,957 T235S probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clk2 G A 3: 89,167,191 V53I probably benign Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
Eral1 A G 11: 78,074,533 I352T possibly damaging Het
F2 T C 2: 91,628,696 H476R possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Obsl1 A T 1: 75,503,523 C460S probably benign Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Orai3 G A 7: 127,773,571 G130S unknown Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmeff2 A T 1: 50,979,416 N186Y probably benign Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in Trpv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Trpv1 APN 11 73260362 missense probably damaging 0.99
IGL01348:Trpv1 APN 11 73238252 unclassified probably null
IGL01568:Trpv1 APN 11 73238443 missense probably benign 0.01
IGL01638:Trpv1 APN 11 73253329 missense probably damaging 0.98
IGL02092:Trpv1 APN 11 73246079 splice site probably benign
IGL02167:Trpv1 APN 11 73254797 missense probably damaging 1.00
IGL02649:Trpv1 APN 11 73250786 missense probably damaging 1.00
IGL03396:Trpv1 APN 11 73253056 missense probably benign 0.01
IGL03402:Trpv1 APN 11 73239637 missense possibly damaging 0.73
R0112:Trpv1 UTSW 11 73253272 missense probably damaging 1.00
R0433:Trpv1 UTSW 11 73253008 splice site probably benign
R0482:Trpv1 UTSW 11 73239429 missense probably damaging 1.00
R0494:Trpv1 UTSW 11 73260442 missense probably benign
R1401:Trpv1 UTSW 11 73240126 splice site probably null
R2032:Trpv1 UTSW 11 73238385 missense probably benign
R2199:Trpv1 UTSW 11 73240251 missense probably damaging 0.96
R2263:Trpv1 UTSW 11 73241682 missense probably damaging 1.00
R2939:Trpv1 UTSW 11 73254849 missense probably damaging 0.99
R2940:Trpv1 UTSW 11 73254849 missense probably damaging 0.99
R3743:Trpv1 UTSW 11 73254302 missense probably damaging 1.00
R3805:Trpv1 UTSW 11 73253053 missense probably damaging 0.99
R4073:Trpv1 UTSW 11 73250780 missense probably damaging 0.96
R4294:Trpv1 UTSW 11 73240464 missense probably damaging 1.00
R4650:Trpv1 UTSW 11 73238263 missense probably benign 0.04
R4700:Trpv1 UTSW 11 73251284 missense possibly damaging 0.47
R5114:Trpv1 UTSW 11 73241748 missense probably damaging 1.00
R5153:Trpv1 UTSW 11 73238516 missense probably benign 0.32
R5319:Trpv1 UTSW 11 73239589 missense probably damaging 0.99
R5516:Trpv1 UTSW 11 73245983 missense probably benign 0.44
R5845:Trpv1 UTSW 11 73240581 missense probably damaging 1.00
R6134:Trpv1 UTSW 11 73244317 missense probably benign 0.01
R6232:Trpv1 UTSW 11 73250810 missense possibly damaging 0.88
R6383:Trpv1 UTSW 11 73246036 missense probably damaging 1.00
R7200:Trpv1 UTSW 11 73239586 missense probably damaging 1.00
R7319:Trpv1 UTSW 11 73250794 missense probably benign 0.01
R7323:Trpv1 UTSW 11 73260337 missense possibly damaging 0.82
R7361:Trpv1 UTSW 11 73260377 missense probably damaging 0.99
R7373:Trpv1 UTSW 11 73240673 missense probably damaging 1.00
R7444:Trpv1 UTSW 11 73244204 missense possibly damaging 0.89
R7488:Trpv1 UTSW 11 73238529 missense probably benign 0.00
R7513:Trpv1 UTSW 11 73240541 missense probably damaging 1.00
X0067:Trpv1 UTSW 11 73244201 critical splice acceptor site probably null
Z1176:Trpv1 UTSW 11 73240188 missense probably damaging 1.00
Z1176:Trpv1 UTSW 11 73240507 missense probably damaging 1.00
Z1177:Trpv1 UTSW 11 73254773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAATTAGCAGGCAGACAC -3'
(R):5'- TATGTCTAGCCTCAGGGAGC -3'

Sequencing Primer
(F):5'- GAATTAGCAGGCAGACACCAACC -3'
(R):5'- GAGCCCTGAGCCTGATCTCTAC -3'
Posted On2019-11-26