Incidental Mutation 'R7762:Eral1'
ID597958
Institutional Source Beutler Lab
Gene Symbol Eral1
Ensembl Gene ENSMUSG00000020832
Gene NameEra (G-protein)-like 1 (E. coli)
Synonyms2610524P08Rik, 9130407C09Rik, MERA-W, MERA-S
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7762 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78073376-78080383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78074533 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 352 (I352T)
Ref Sequence ENSEMBL: ENSMUSP00000021183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021183
AA Change: I352T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021183
Gene: ENSMUSG00000020832
AA Change: I352T

DomainStartEndE-ValueType
low complexity region 79 92 N/A INTRINSIC
Pfam:AIG1 114 249 2.2e-11 PFAM
Pfam:FeoB_N 114 260 5e-10 PFAM
Pfam:MMR_HSR1 115 237 4e-21 PFAM
Pfam:Dynamin_N 116 162 1.6e-6 PFAM
Pfam:KH_2 363 437 6.3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase that localizes to the mitochondrion. The encoded protein binds to the 3' terminal stem loop of 12S mitochondrial rRNA and is required for proper assembly of the 28S small mitochondrial ribosomal subunit. Deletion of this gene has been shown to cause mitochondrial dysfunction, growth retardation, and apoptosis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,932,686 V622I probably benign Het
9130011E15Rik A G 19: 45,940,443 probably null Het
Acod1 T G 14: 103,051,340 D95E probably damaging Het
Agpat4 A G 17: 12,210,322 T154A possibly damaging Het
Ahnak2 A T 12: 112,775,680 S653T probably benign Het
Aox2 C T 1: 58,349,104 P1124S probably damaging Het
Atp4a T C 7: 30,720,036 I637T probably damaging Het
Atxn7 T A 14: 14,100,467 C718S probably damaging Het
Btbd2 T A 10: 80,643,556 I516F probably damaging Het
Card6 A G 15: 5,105,338 S128P probably benign Het
Cat T C 2: 103,456,858 K476E probably benign Het
Ccr9 A T 9: 123,779,957 T235S probably benign Het
Cep55 T G 19: 38,069,069 probably null Het
Clec2e A G 6: 129,095,128 F96S possibly damaging Het
Clk2 G A 3: 89,167,191 V53I probably benign Het
Clnk T C 5: 38,768,141 M106V probably benign Het
Col6a5 T C 9: 105,931,324 I842V unknown Het
Csf1r A T 18: 61,110,500 N196I probably benign Het
D5Ertd579e A T 5: 36,613,381 N116K Het
Dnaja4 A G 9: 54,709,210 I166V probably benign Het
Dqx1 A G 6: 83,061,032 E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 T1760A probably benign Het
Eea1 T C 10: 96,028,439 V940A probably benign Het
Egr1 T A 18: 34,863,545 V460E probably damaging Het
F2 T C 2: 91,628,696 H476R possibly damaging Het
Fam83b A G 9: 76,492,432 V463A possibly damaging Het
Fat1 T C 8: 45,023,322 S1802P probably damaging Het
Fat1 T A 8: 45,037,337 L3762H probably damaging Het
Fibp A T 19: 5,464,174 N296Y probably benign Het
Figla A G 6: 86,017,326 M28V probably benign Het
Foxd3 C A 4: 99,657,125 Y167* probably null Het
Gm17019 T A 5: 15,030,992 H145L probably benign Het
Gm340 T C 19: 41,583,667 L287S probably benign Het
Gm48552 C T 10: 81,390,435 P18L probably damaging Het
Gm9573 G A 17: 35,622,085 T403I unknown Het
H2-Q6 A G 17: 35,428,101 N283S probably benign Het
Hrh2 T A 13: 54,214,039 C11* probably null Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Iapp C A 6: 142,303,396 N58K possibly damaging Het
Itga5 T C 15: 103,349,757 N837S probably benign Het
Klhl35 C A 7: 99,468,440 H64N probably benign Het
Lrba T A 3: 86,532,201 V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 I3276T probably benign Het
Mlh3 G T 12: 85,268,284 T376K possibly damaging Het
Nbea A T 3: 55,649,705 H2550Q probably damaging Het
Nid1 G A 13: 13,489,045 G763D probably damaging Het
Ntf5 C A 7: 45,415,819 A125E probably damaging Het
Obsl1 A T 1: 75,503,523 C460S probably benign Het
Olfr1272 T A 2: 90,296,631 K77* probably null Het
Olfr130 G A 17: 38,067,675 C168Y probably damaging Het
Olfr1380 T A 11: 49,564,761 I280N possibly damaging Het
Olfr1496 A T 19: 13,781,286 R223W probably damaging Het
Olfr348 A T 2: 36,787,010 I162F probably benign Het
Olfr820 A G 10: 130,017,181 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Orai3 G A 7: 127,773,571 G130S unknown Het
Pcdhb12 T G 18: 37,435,924 V41G probably damaging Het
Plec A T 15: 76,183,623 L1194Q unknown Het
Pml C A 9: 58,220,173 C763F probably damaging Het
Prdm15 T A 16: 97,818,273 I318F probably benign Het
Rcbtb2 C A 14: 73,178,466 T473N probably benign Het
Sbno1 T A 5: 124,374,666 I1347F probably benign Het
Secisbp2l C T 2: 125,768,193 D269N probably damaging Het
Serpina9 A T 12: 104,001,316 F273L probably damaging Het
Sgms2 T A 3: 131,323,249 Y319F probably benign Het
Sgo2b A T 8: 63,926,497 H1100Q probably benign Het
Sh3bp5l A T 11: 58,345,928 probably null Het
Shh T G 5: 28,466,666 K33T probably benign Het
Slc5a9 A G 4: 111,890,174 Y339H probably damaging Het
Spice1 T A 16: 44,370,501 probably null Het
Tbx2 A G 11: 85,835,901 E257G probably damaging Het
Tenm2 G A 11: 36,023,306 T2468I possibly damaging Het
Tmeff2 A T 1: 50,979,416 N186Y probably benign Het
Tmem132c T C 5: 127,554,696 V673A possibly damaging Het
Trappc11 G T 8: 47,522,376 T269K probably damaging Het
Trpc6 T C 9: 8,653,149 F652S possibly damaging Het
Trpv1 G T 11: 73,254,222 K711N probably benign Het
Vcan G T 13: 89,692,937 P1496Q probably damaging Het
Vmn1r192 G T 13: 22,187,675 A125E probably damaging Het
Vti1b A T 12: 79,164,946 probably null Het
Vwa3b A C 1: 37,124,045 D583A probably damaging Het
Zfp638 T C 6: 83,976,272 S1120P probably damaging Het
Zfyve26 A T 12: 79,268,635 F1356I probably benign Het
Other mutations in Eral1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Eral1 APN 11 78075732 missense probably damaging 1.00
IGL01643:Eral1 APN 11 78074278 critical splice donor site probably null
IGL02240:Eral1 APN 11 78077861 nonsense probably null
IGL03085:Eral1 APN 11 78078267 missense probably damaging 1.00
K3955:Eral1 UTSW 11 78076021 missense probably damaging 1.00
P0038:Eral1 UTSW 11 78076021 missense probably damaging 1.00
R0240:Eral1 UTSW 11 78076058 splice site probably benign
R1084:Eral1 UTSW 11 78074498 missense probably damaging 0.96
R1563:Eral1 UTSW 11 78075406 missense probably benign 0.39
R1881:Eral1 UTSW 11 78076049 missense possibly damaging 0.67
R1995:Eral1 UTSW 11 78074489 missense probably benign
R2189:Eral1 UTSW 11 78075831 missense probably benign 0.15
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R4049:Eral1 UTSW 11 78075602 missense probably damaging 1.00
R4585:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4586:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4758:Eral1 UTSW 11 78075599 missense probably benign 0.20
R5450:Eral1 UTSW 11 78078357 missense probably benign 0.23
R5613:Eral1 UTSW 11 78074404 intron probably benign
R5987:Eral1 UTSW 11 78080233 missense possibly damaging 0.90
R6048:Eral1 UTSW 11 78075783 missense probably benign 0.03
R6363:Eral1 UTSW 11 78074317 missense probably damaging 1.00
R6891:Eral1 UTSW 11 78075733 missense possibly damaging 0.76
R7384:Eral1 UTSW 11 78074101 missense possibly damaging 0.81
R7468:Eral1 UTSW 11 78075393 missense probably damaging 1.00
X0066:Eral1 UTSW 11 78075765 missense probably damaging 1.00
Z1176:Eral1 UTSW 11 78075620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCTGTTGGATCACTAGCTC -3'
(R):5'- GCCTTTTCCTCCTAGAAGCATG -3'

Sequencing Primer
(F):5'- GGATCACTAGCTCTCCACTTGG -3'
(R):5'- TGCATAAACAAATGTTCTGATGGGG -3'
Posted On2019-11-26