Mutagenetix > Incidental Mutation

Incidental Mutation 'R7762:Atxn7'

597969

Institutional Source

Beutler Lab

Gene Symbol

Atxn7

Ensembl Gene

ENSMUSG00000021738

Gene Name

ataxin 7

Synonyms

A430107N12Rik, ataxin-7, Sca7

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7762 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13961440-14107302 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14100467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 718 (C718S)

Ref Sequence

ENSEMBL: ENSMUSP00000022257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]

AlphaFold

Q8R4I1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022257
AA Change: C718S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: C718S

Domain	Start	End	E-Value	Type
low complexity region	13	47	N/A	INTRINSIC
low complexity region	50	66	N/A	INTRINSIC
ZnF_C2H2	135	157	2.47e1	SMART
low complexity region	174	197	N/A	INTRINSIC
low complexity region	202	218	N/A	INTRINSIC
Pfam:SCA7	313	381	1.4e-30	PFAM
low complexity region	393	413	N/A	INTRINSIC
low complexity region	470	484	N/A	INTRINSIC
low complexity region	619	647	N/A	INTRINSIC
low complexity region	675	713	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223714
AA Change: C718S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223880
AA Change: C718S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000224315

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	G	A	6: 48,932,686	V622I	probably benign	Het
9130011E15Rik	A	G	19: 45,940,443		probably null	Het
Acod1	T	G	14: 103,051,340	D95E	probably damaging	Het
Agpat4	A	G	17: 12,210,322	T154A	possibly damaging	Het
Ahnak2	A	T	12: 112,775,680	S653T	probably benign	Het
Aox2	C	T	1: 58,349,104	P1124S	probably damaging	Het
Atp4a	T	C	7: 30,720,036	I637T	probably damaging	Het
Btbd2	T	A	10: 80,643,556	I516F	probably damaging	Het
Card6	A	G	15: 5,105,338	S128P	probably benign	Het
Cat	T	C	2: 103,456,858	K476E	probably benign	Het
Ccr9	A	T	9: 123,779,957	T235S	probably benign	Het
Cep55	T	G	19: 38,069,069		probably null	Het
Clec2e	A	G	6: 129,095,128	F96S	possibly damaging	Het
Clk2	G	A	3: 89,167,191	V53I	probably benign	Het
Clnk	T	C	5: 38,768,141	M106V	probably benign	Het
Col6a5	T	C	9: 105,931,324	I842V	unknown	Het
Csf1r	A	T	18: 61,110,500	N196I	probably benign	Het
D5Ertd579e	A	T	5: 36,613,381	N116K		Het
Dnaja4	A	G	9: 54,709,210	I166V	probably benign	Het
Dqx1	A	G	6: 83,061,032	E467G	probably damaging	Het
Dync2h1	T	C	9: 7,129,719	T1760A	probably benign	Het
Eea1	T	C	10: 96,028,439	V940A	probably benign	Het
Egr1	T	A	18: 34,863,545	V460E	probably damaging	Het
Eral1	A	G	11: 78,074,533	I352T	possibly damaging	Het
F2	T	C	2: 91,628,696	H476R	possibly damaging	Het
Fam83b	A	G	9: 76,492,432	V463A	possibly damaging	Het
Fat1	T	C	8: 45,023,322	S1802P	probably damaging	Het
Fat1	T	A	8: 45,037,337	L3762H	probably damaging	Het
Fibp	A	T	19: 5,464,174	N296Y	probably benign	Het
Figla	A	G	6: 86,017,326	M28V	probably benign	Het
Foxd3	C	A	4: 99,657,125	Y167*	probably null	Het
Gm17019	T	A	5: 15,030,992	H145L	probably benign	Het
Gm340	T	C	19: 41,583,667	L287S	probably benign	Het
Gm48552	C	T	10: 81,390,435	P18L	probably damaging	Het
Gm9573	G	A	17: 35,622,085	T403I	unknown	Het
H2-Q6	A	G	17: 35,428,101	N283S	probably benign	Het
Hrh2	T	A	13: 54,214,039	C11*	probably null	Het
Hrnr	G	T	3: 93,332,199	G3248V	unknown	Het
Iapp	C	A	6: 142,303,396	N58K	possibly damaging	Het
Itga5	T	C	15: 103,349,757	N837S	probably benign	Het
Klhl35	C	A	7: 99,468,440	H64N	probably benign	Het
Lrba	T	A	3: 86,532,201	V2015E	probably damaging	Het
Mdn1	T	C	4: 32,734,421	I3276T	probably benign	Het
Mlh3	G	T	12: 85,268,284	T376K	possibly damaging	Het
Nbea	A	T	3: 55,649,705	H2550Q	probably damaging	Het
Nid1	G	A	13: 13,489,045	G763D	probably damaging	Het
Ntf5	C	A	7: 45,415,819	A125E	probably damaging	Het
Obsl1	A	T	1: 75,503,523	C460S	probably benign	Het
Olfr1272	T	A	2: 90,296,631	K77*	probably null	Het
Olfr130	G	A	17: 38,067,675	C168Y	probably damaging	Het
Olfr1380	T	A	11: 49,564,761	I280N	possibly damaging	Het
Olfr1496	A	T	19: 13,781,286	R223W	probably damaging	Het
Olfr348	A	T	2: 36,787,010	I162F	probably benign	Het
Olfr820	A	G	10: 130,017,181		probably benign	Het
Olfr933	G	A	9: 38,976,194	V173I	probably benign	Het
Orai3	G	A	7: 127,773,571	G130S	unknown	Het
Pcdhb12	T	G	18: 37,435,924	V41G	probably damaging	Het
Plec	A	T	15: 76,183,623	L1194Q	unknown	Het
Pml	C	A	9: 58,220,173	C763F	probably damaging	Het
Prdm15	T	A	16: 97,818,273	I318F	probably benign	Het
Rcbtb2	C	A	14: 73,178,466	T473N	probably benign	Het
Sbno1	T	A	5: 124,374,666	I1347F	probably benign	Het
Secisbp2l	C	T	2: 125,768,193	D269N	probably damaging	Het
Serpina9	A	T	12: 104,001,316	F273L	probably damaging	Het
Sgms2	T	A	3: 131,323,249	Y319F	probably benign	Het
Sgo2b	A	T	8: 63,926,497	H1100Q	probably benign	Het
Sh3bp5l	A	T	11: 58,345,928		probably null	Het
Shh	T	G	5: 28,466,666	K33T	probably benign	Het
Slc5a9	A	G	4: 111,890,174	Y339H	probably damaging	Het
Spice1	T	A	16: 44,370,501		probably null	Het
Tbx2	A	G	11: 85,835,901	E257G	probably damaging	Het
Tenm2	G	A	11: 36,023,306	T2468I	possibly damaging	Het
Tmeff2	A	T	1: 50,979,416	N186Y	probably benign	Het
Tmem132c	T	C	5: 127,554,696	V673A	possibly damaging	Het
Trappc11	G	T	8: 47,522,376	T269K	probably damaging	Het
Trpc6	T	C	9: 8,653,149	F652S	possibly damaging	Het
Trpv1	G	T	11: 73,254,222	K711N	probably benign	Het
Vcan	G	T	13: 89,692,937	P1496Q	probably damaging	Het
Vmn1r192	G	T	13: 22,187,675	A125E	probably damaging	Het
Vti1b	A	T	12: 79,164,946		probably null	Het
Vwa3b	A	C	1: 37,124,045	D583A	probably damaging	Het
Zfp638	T	C	6: 83,976,272	S1120P	probably damaging	Het
Zfyve26	A	T	12: 79,268,635	F1356I	probably benign	Het

Other mutations in Atxn7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Atxn7	APN	14	14096324	splice site	probably benign
IGL00782:Atxn7	APN	14	14096218	missense	possibly damaging	0.78
IGL01405:Atxn7	APN	14	14100105	missense	probably benign	0.00
IGL02828:Atxn7	APN	14	14090056	missense	probably damaging	1.00
IGL03119:Atxn7	APN	14	14100734	missense	probably damaging	1.00
IGL03139:Atxn7	APN	14	14052994	missense	probably damaging	0.97
IGL03282:Atxn7	APN	14	14100564	missense	probably damaging	0.99
IGL03387:Atxn7	APN	14	14087273	splice site	probably benign
Estes_park	UTSW	14	14096317	critical splice donor site	probably null
Lumpy	UTSW	14	14089446	nonsense	probably null
Oestes_park	UTSW	14	14096268	nonsense	probably null
R0034:Atxn7	UTSW	14	14100846	missense	probably damaging	0.96
R0408:Atxn7	UTSW	14	14100317	missense	probably damaging	1.00
R0853:Atxn7	UTSW	14	14089465	splice site	probably benign
R1169:Atxn7	UTSW	14	14095468	missense	possibly damaging	0.81
R1678:Atxn7	UTSW	14	14096239	missense	probably damaging	1.00
R1802:Atxn7	UTSW	14	14089419	missense	probably benign	0.25
R2078:Atxn7	UTSW	14	14052975	missense	probably damaging	0.99
R2275:Atxn7	UTSW	14	14013268	missense	possibly damaging	0.85
R2394:Atxn7	UTSW	14	14100237	missense	probably damaging	1.00
R4118:Atxn7	UTSW	14	14100308	missense	probably benign	0.00
R4230:Atxn7	UTSW	14	14100381	missense	probably benign	0.00
R4588:Atxn7	UTSW	14	14096268	nonsense	probably null
R4688:Atxn7	UTSW	14	14089288	missense	probably benign	0.00
R4935:Atxn7	UTSW	14	14100401	missense	probably benign
R5041:Atxn7	UTSW	14	14096317	critical splice donor site	probably null
R5185:Atxn7	UTSW	14	14090063	missense	probably benign	0.04
R5561:Atxn7	UTSW	14	14089260	missense	probably benign	0.19
R5641:Atxn7	UTSW	14	14013638	missense	probably damaging	0.99
R6490:Atxn7	UTSW	14	14089446	nonsense	probably null
R6549:Atxn7	UTSW	14	14013087	missense	probably damaging	0.99
R6623:Atxn7	UTSW	14	14099972	missense	probably damaging	1.00
R6950:Atxn7	UTSW	14	14095511	missense	probably damaging	1.00
R7054:Atxn7	UTSW	14	14100878	missense	probably benign	0.08
R7402:Atxn7	UTSW	14	14095427	missense	probably damaging	0.98
R8432:Atxn7	UTSW	14	14013635	missense	probably benign	0.06
R8786:Atxn7	UTSW	14	14103316	missense	possibly damaging	0.78
R9238:Atxn7	UTSW	14	14089441	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCCCAAGGAATCTTCTGC -3'
(R):5'- CACTAGCCTGGTGGATGAATG -3'

Sequencing Primer
(F):5'- AAGGAATCTTCTGCTCTCAGC -3'
(R):5'- TGGAGTCGCTGCTGTTCACC -3'

Posted On

2019-11-26