Incidental Mutation 'R7762:Rcbtb2'
ID 597970
Institutional Source Beutler Lab
Gene Symbol Rcbtb2
Ensembl Gene ENSMUSG00000022106
Gene Name regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
Synonyms Rc/btb2, 2810420M18Rik, 2610028E02Rik, Chc1l
MMRRC Submission 045818-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.274) question?
Stock # R7762 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 73376185-73421495 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73415906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 473 (T473N)
Ref Sequence ENSEMBL: ENSMUSP00000131588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022702] [ENSMUST00000110952] [ENSMUST00000163797] [ENSMUST00000164298] [ENSMUST00000164822] [ENSMUST00000167401] [ENSMUST00000169479] [ENSMUST00000169513] [ENSMUST00000170677] [ENSMUST00000171767]
AlphaFold Q99LJ7
Predicted Effect probably benign
Transcript: ENSMUST00000022702
AA Change: T473N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022702
Gene: ENSMUSG00000022106
AA Change: T473N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110952
AA Change: T473N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106577
Gene: ENSMUSG00000022106
AA Change: T473N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 3e-16 PFAM
Pfam:RCC1_2 154 183 7.8e-15 PFAM
Pfam:RCC1 170 220 1.4e-15 PFAM
Pfam:RCC1 223 272 9.4e-18 PFAM
Pfam:RCC1_2 259 288 2.6e-11 PFAM
Pfam:RCC1 275 324 1.2e-13 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163797
SMART Domains Protein: ENSMUSP00000132125
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 136 174 7.7e-12 PFAM
low complexity region 199 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164298
SMART Domains Protein: ENSMUSP00000126651
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 103 153 2.9e-17 PFAM
Pfam:RCC1_2 140 169 2.2e-15 PFAM
Pfam:RCC1 156 206 4.4e-15 PFAM
Pfam:RCC1 209 247 1.2e-11 PFAM
low complexity region 272 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164822
AA Change: T473N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131588
Gene: ENSMUSG00000022106
AA Change: T473N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166875
SMART Domains Protein: ENSMUSP00000130168
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
BTB 32 118 1.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167401
Predicted Effect probably benign
Transcript: ENSMUST00000169479
AA Change: T473N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126898
Gene: ENSMUSG00000022106
AA Change: T473N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169513
AA Change: T449N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128579
Gene: ENSMUSG00000022106
AA Change: T449N

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170677
AA Change: T449N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126510
Gene: ENSMUSG00000022106
AA Change: T449N

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171767
AA Change: T473N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106
AA Change: T473N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T G 14: 103,288,776 (GRCm39) D95E probably damaging Het
Agpat4 A G 17: 12,429,209 (GRCm39) T154A possibly damaging Het
Ahnak2 A T 12: 112,742,114 (GRCm39) S653T probably benign Het
Aoc1l2 G A 6: 48,909,620 (GRCm39) V622I probably benign Het
Aox1 C T 1: 58,388,263 (GRCm39) P1124S probably damaging Het
Armh3 A G 19: 45,928,882 (GRCm39) probably null Het
Atp4a T C 7: 30,419,461 (GRCm39) I637T probably damaging Het
Atxn7 T A 14: 14,100,467 (GRCm38) C718S probably damaging Het
Btbd2 T A 10: 80,479,390 (GRCm39) I516F probably damaging Het
Card6 A G 15: 5,134,820 (GRCm39) S128P probably benign Het
Cat T C 2: 103,287,203 (GRCm39) K476E probably benign Het
Ccr9 A T 9: 123,609,022 (GRCm39) T235S probably benign Het
Cep55 T G 19: 38,057,517 (GRCm39) probably null Het
Clec2e A G 6: 129,072,091 (GRCm39) F96S possibly damaging Het
Clk2 G A 3: 89,074,498 (GRCm39) V53I probably benign Het
Clnk T C 5: 38,925,484 (GRCm39) M106V probably benign Het
Col6a5 T C 9: 105,808,523 (GRCm39) I842V unknown Het
Csf1r A T 18: 61,243,572 (GRCm39) N196I probably benign Het
D5Ertd579e A T 5: 36,770,725 (GRCm39) N116K Het
Dnaja4 A G 9: 54,616,494 (GRCm39) I166V probably benign Het
Dqx1 A G 6: 83,038,013 (GRCm39) E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 (GRCm39) T1760A probably benign Het
Eea1 T C 10: 95,864,301 (GRCm39) V940A probably benign Het
Egr1 T A 18: 34,996,598 (GRCm39) V460E probably damaging Het
Eral1 A G 11: 77,965,359 (GRCm39) I352T possibly damaging Het
F2 T C 2: 91,459,041 (GRCm39) H476R possibly damaging Het
Fam83b A G 9: 76,399,714 (GRCm39) V463A possibly damaging Het
Fat1 T A 8: 45,490,374 (GRCm39) L3762H probably damaging Het
Fat1 T C 8: 45,476,359 (GRCm39) S1802P probably damaging Het
Fibp A T 19: 5,514,202 (GRCm39) N296Y probably benign Het
Figla A G 6: 85,994,308 (GRCm39) M28V probably benign Het
Foxd3 C A 4: 99,545,362 (GRCm39) Y167* probably null Het
Gm17019 T A 5: 15,081,006 (GRCm39) H145L probably benign Het
Gm48552 C T 10: 81,226,269 (GRCm39) P18L probably damaging Het
H2-Q6 A G 17: 35,647,077 (GRCm39) N283S probably benign Het
Hrh2 T A 13: 54,368,058 (GRCm39) C11* probably null Het
Hrnr G T 3: 93,239,506 (GRCm39) G3248V unknown Het
Iapp C A 6: 142,249,122 (GRCm39) N58K possibly damaging Het
Itga5 T C 15: 103,258,184 (GRCm39) N837S probably benign Het
Klhl35 C A 7: 99,117,647 (GRCm39) H64N probably benign Het
Lcor T C 19: 41,572,106 (GRCm39) L287S probably benign Het
Lrba T A 3: 86,439,508 (GRCm39) V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 (GRCm39) I3276T probably benign Het
Mlh3 G T 12: 85,315,058 (GRCm39) T376K possibly damaging Het
Muc21 G A 17: 35,932,977 (GRCm39) T403I unknown Het
Nbea A T 3: 55,557,126 (GRCm39) H2550Q probably damaging Het
Nid1 G A 13: 13,663,630 (GRCm39) G763D probably damaging Het
Ntf5 C A 7: 45,065,243 (GRCm39) A125E probably damaging Het
Obsl1 A T 1: 75,480,167 (GRCm39) C460S probably benign Het
Or1j19 A T 2: 36,677,022 (GRCm39) I162F probably benign Het
Or1s2 A T 19: 13,758,650 (GRCm39) R223W probably damaging Het
Or2g7 G A 17: 38,378,566 (GRCm39) C168Y probably damaging Het
Or2y10 T A 11: 49,455,588 (GRCm39) I280N possibly damaging Het
Or4b1b T A 2: 90,126,975 (GRCm39) K77* probably null Het
Or6c33 A G 10: 129,853,050 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Orai3 G A 7: 127,372,743 (GRCm39) G130S unknown Het
Pcdhb12 T G 18: 37,568,977 (GRCm39) V41G probably damaging Het
Plec A T 15: 76,067,823 (GRCm39) L1194Q unknown Het
Pml C A 9: 58,127,456 (GRCm39) C763F probably damaging Het
Prdm15 T A 16: 97,619,473 (GRCm39) I318F probably benign Het
Sbno1 T A 5: 124,512,729 (GRCm39) I1347F probably benign Het
Secisbp2l C T 2: 125,610,113 (GRCm39) D269N probably damaging Het
Serpina9 A T 12: 103,967,575 (GRCm39) F273L probably damaging Het
Sgms2 T A 3: 131,116,898 (GRCm39) Y319F probably benign Het
Sgo2b A T 8: 64,379,531 (GRCm39) H1100Q probably benign Het
Sh3bp5l A T 11: 58,236,754 (GRCm39) probably null Het
Shh T G 5: 28,671,664 (GRCm39) K33T probably benign Het
Slc5a9 A G 4: 111,747,371 (GRCm39) Y339H probably damaging Het
Spice1 T A 16: 44,190,864 (GRCm39) probably null Het
Tbx2 A G 11: 85,726,727 (GRCm39) E257G probably damaging Het
Tenm2 G A 11: 35,914,133 (GRCm39) T2468I possibly damaging Het
Tmeff2 A T 1: 51,018,575 (GRCm39) N186Y probably benign Het
Tmem132c T C 5: 127,631,760 (GRCm39) V673A possibly damaging Het
Trappc11 G T 8: 47,975,411 (GRCm39) T269K probably damaging Het
Trpc6 T C 9: 8,653,150 (GRCm39) F652S possibly damaging Het
Trpv1 G T 11: 73,145,048 (GRCm39) K711N probably benign Het
Vcan G T 13: 89,841,056 (GRCm39) P1496Q probably damaging Het
Vmn1r192 G T 13: 22,371,845 (GRCm39) A125E probably damaging Het
Vti1b A T 12: 79,211,720 (GRCm39) probably null Het
Vwa3b A C 1: 37,163,126 (GRCm39) D583A probably damaging Het
Zfp638 T C 6: 83,953,254 (GRCm39) S1120P probably damaging Het
Zfyve26 A T 12: 79,315,409 (GRCm39) F1356I probably benign Het
Other mutations in Rcbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Rcbtb2 APN 14 73,402,222 (GRCm39) missense possibly damaging 0.94
IGL02550:Rcbtb2 APN 14 73,399,459 (GRCm39) missense probably damaging 1.00
IGL02800:Rcbtb2 APN 14 73,405,543 (GRCm39) nonsense probably null
IGL02811:Rcbtb2 APN 14 73,411,851 (GRCm39) missense probably damaging 1.00
R0319:Rcbtb2 UTSW 14 73,415,909 (GRCm39) missense probably benign 0.04
R0390:Rcbtb2 UTSW 14 73,415,987 (GRCm39) missense probably damaging 0.96
R0448:Rcbtb2 UTSW 14 73,415,869 (GRCm39) splice site probably benign
R1298:Rcbtb2 UTSW 14 73,399,828 (GRCm39) missense probably damaging 0.99
R1567:Rcbtb2 UTSW 14 73,399,902 (GRCm39) missense probably benign 0.07
R2014:Rcbtb2 UTSW 14 73,411,826 (GRCm39) splice site probably benign
R2137:Rcbtb2 UTSW 14 73,399,491 (GRCm39) missense probably damaging 1.00
R2218:Rcbtb2 UTSW 14 73,416,005 (GRCm39) critical splice donor site probably null
R4505:Rcbtb2 UTSW 14 73,411,345 (GRCm39) missense probably damaging 1.00
R5832:Rcbtb2 UTSW 14 73,404,262 (GRCm39) missense possibly damaging 0.95
R5898:Rcbtb2 UTSW 14 73,399,405 (GRCm39) nonsense probably null
R6484:Rcbtb2 UTSW 14 73,414,490 (GRCm39) missense probably damaging 0.99
R7252:Rcbtb2 UTSW 14 73,404,220 (GRCm39) missense probably damaging 1.00
R7606:Rcbtb2 UTSW 14 73,419,806 (GRCm39) splice site probably null
R7654:Rcbtb2 UTSW 14 73,411,941 (GRCm39) missense probably benign 0.00
R7951:Rcbtb2 UTSW 14 73,403,992 (GRCm39) nonsense probably null
R7960:Rcbtb2 UTSW 14 73,399,384 (GRCm39) missense probably benign 0.01
R8086:Rcbtb2 UTSW 14 73,411,305 (GRCm39) missense probably damaging 1.00
R8366:Rcbtb2 UTSW 14 73,444,632 (GRCm39) missense probably benign 0.00
R8696:Rcbtb2 UTSW 14 73,404,305 (GRCm39) missense probably damaging 0.99
R9206:Rcbtb2 UTSW 14 73,414,500 (GRCm39) missense probably damaging 1.00
R9208:Rcbtb2 UTSW 14 73,414,500 (GRCm39) missense probably damaging 1.00
R9237:Rcbtb2 UTSW 14 73,411,936 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGTCAGCTCAGCTCAG -3'
(R):5'- GACACGTTTGATGCCATTATAGTC -3'

Sequencing Primer
(F):5'- AGCTCAGCTGTCTTCCCGG -3'
(R):5'- TGATGCCATTATAGTCACATAAGTTC -3'
Posted On 2019-11-26