Incidental Mutation 'R7762:Muc21'
ID 597978
Institutional Source Beutler Lab
Gene Symbol Muc21
Ensembl Gene ENSMUSG00000090588
Gene Name mucin 21
Synonyms epiglycanin, Gm9573
MMRRC Submission 045818-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R7762 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 35928815-35937529 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35932977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 403 (T403I)
Ref Sequence ENSEMBL: ENSMUSP00000130987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164502] [ENSMUST00000174521]
AlphaFold F7C950
Predicted Effect unknown
Transcript: ENSMUST00000164502
AA Change: T403I
SMART Domains Protein: ENSMUSP00000130987
Gene: ENSMUSG00000090588
AA Change: T403I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 76 144 N/A INTRINSIC
low complexity region 149 578 N/A INTRINSIC
low complexity region 580 653 N/A INTRINSIC
low complexity region 655 1179 N/A INTRINSIC
low complexity region 1183 1373 N/A INTRINSIC
low complexity region 1383 1436 N/A INTRINSIC
low complexity region 1438 1479 N/A INTRINSIC
Pfam:Epiglycanin_C 1518 1605 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174521
SMART Domains Protein: ENSMUSP00000134221
Gene: ENSMUSG00000090509

DomainStartEndE-ValueType
Pfam:SFTA2 80 117 9.2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T G 14: 103,288,776 (GRCm39) D95E probably damaging Het
Agpat4 A G 17: 12,429,209 (GRCm39) T154A possibly damaging Het
Ahnak2 A T 12: 112,742,114 (GRCm39) S653T probably benign Het
Aoc1l2 G A 6: 48,909,620 (GRCm39) V622I probably benign Het
Aox1 C T 1: 58,388,263 (GRCm39) P1124S probably damaging Het
Armh3 A G 19: 45,928,882 (GRCm39) probably null Het
Atp4a T C 7: 30,419,461 (GRCm39) I637T probably damaging Het
Atxn7 T A 14: 14,100,467 (GRCm38) C718S probably damaging Het
Btbd2 T A 10: 80,479,390 (GRCm39) I516F probably damaging Het
Card6 A G 15: 5,134,820 (GRCm39) S128P probably benign Het
Cat T C 2: 103,287,203 (GRCm39) K476E probably benign Het
Ccr9 A T 9: 123,609,022 (GRCm39) T235S probably benign Het
Cep55 T G 19: 38,057,517 (GRCm39) probably null Het
Clec2e A G 6: 129,072,091 (GRCm39) F96S possibly damaging Het
Clk2 G A 3: 89,074,498 (GRCm39) V53I probably benign Het
Clnk T C 5: 38,925,484 (GRCm39) M106V probably benign Het
Col6a5 T C 9: 105,808,523 (GRCm39) I842V unknown Het
Csf1r A T 18: 61,243,572 (GRCm39) N196I probably benign Het
D5Ertd579e A T 5: 36,770,725 (GRCm39) N116K Het
Dnaja4 A G 9: 54,616,494 (GRCm39) I166V probably benign Het
Dqx1 A G 6: 83,038,013 (GRCm39) E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 (GRCm39) T1760A probably benign Het
Eea1 T C 10: 95,864,301 (GRCm39) V940A probably benign Het
Egr1 T A 18: 34,996,598 (GRCm39) V460E probably damaging Het
Eral1 A G 11: 77,965,359 (GRCm39) I352T possibly damaging Het
F2 T C 2: 91,459,041 (GRCm39) H476R possibly damaging Het
Fam83b A G 9: 76,399,714 (GRCm39) V463A possibly damaging Het
Fat1 T A 8: 45,490,374 (GRCm39) L3762H probably damaging Het
Fat1 T C 8: 45,476,359 (GRCm39) S1802P probably damaging Het
Fibp A T 19: 5,514,202 (GRCm39) N296Y probably benign Het
Figla A G 6: 85,994,308 (GRCm39) M28V probably benign Het
Foxd3 C A 4: 99,545,362 (GRCm39) Y167* probably null Het
Gm17019 T A 5: 15,081,006 (GRCm39) H145L probably benign Het
Gm48552 C T 10: 81,226,269 (GRCm39) P18L probably damaging Het
H2-Q6 A G 17: 35,647,077 (GRCm39) N283S probably benign Het
Hrh2 T A 13: 54,368,058 (GRCm39) C11* probably null Het
Hrnr G T 3: 93,239,506 (GRCm39) G3248V unknown Het
Iapp C A 6: 142,249,122 (GRCm39) N58K possibly damaging Het
Itga5 T C 15: 103,258,184 (GRCm39) N837S probably benign Het
Klhl35 C A 7: 99,117,647 (GRCm39) H64N probably benign Het
Lcor T C 19: 41,572,106 (GRCm39) L287S probably benign Het
Lrba T A 3: 86,439,508 (GRCm39) V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 (GRCm39) I3276T probably benign Het
Mlh3 G T 12: 85,315,058 (GRCm39) T376K possibly damaging Het
Nbea A T 3: 55,557,126 (GRCm39) H2550Q probably damaging Het
Nid1 G A 13: 13,663,630 (GRCm39) G763D probably damaging Het
Ntf5 C A 7: 45,065,243 (GRCm39) A125E probably damaging Het
Obsl1 A T 1: 75,480,167 (GRCm39) C460S probably benign Het
Or1j19 A T 2: 36,677,022 (GRCm39) I162F probably benign Het
Or1s2 A T 19: 13,758,650 (GRCm39) R223W probably damaging Het
Or2g7 G A 17: 38,378,566 (GRCm39) C168Y probably damaging Het
Or2y10 T A 11: 49,455,588 (GRCm39) I280N possibly damaging Het
Or4b1b T A 2: 90,126,975 (GRCm39) K77* probably null Het
Or6c33 A G 10: 129,853,050 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Orai3 G A 7: 127,372,743 (GRCm39) G130S unknown Het
Pcdhb12 T G 18: 37,568,977 (GRCm39) V41G probably damaging Het
Plec A T 15: 76,067,823 (GRCm39) L1194Q unknown Het
Pml C A 9: 58,127,456 (GRCm39) C763F probably damaging Het
Prdm15 T A 16: 97,619,473 (GRCm39) I318F probably benign Het
Rcbtb2 C A 14: 73,415,906 (GRCm39) T473N probably benign Het
Sbno1 T A 5: 124,512,729 (GRCm39) I1347F probably benign Het
Secisbp2l C T 2: 125,610,113 (GRCm39) D269N probably damaging Het
Serpina9 A T 12: 103,967,575 (GRCm39) F273L probably damaging Het
Sgms2 T A 3: 131,116,898 (GRCm39) Y319F probably benign Het
Sgo2b A T 8: 64,379,531 (GRCm39) H1100Q probably benign Het
Sh3bp5l A T 11: 58,236,754 (GRCm39) probably null Het
Shh T G 5: 28,671,664 (GRCm39) K33T probably benign Het
Slc5a9 A G 4: 111,747,371 (GRCm39) Y339H probably damaging Het
Spice1 T A 16: 44,190,864 (GRCm39) probably null Het
Tbx2 A G 11: 85,726,727 (GRCm39) E257G probably damaging Het
Tenm2 G A 11: 35,914,133 (GRCm39) T2468I possibly damaging Het
Tmeff2 A T 1: 51,018,575 (GRCm39) N186Y probably benign Het
Tmem132c T C 5: 127,631,760 (GRCm39) V673A possibly damaging Het
Trappc11 G T 8: 47,975,411 (GRCm39) T269K probably damaging Het
Trpc6 T C 9: 8,653,150 (GRCm39) F652S possibly damaging Het
Trpv1 G T 11: 73,145,048 (GRCm39) K711N probably benign Het
Vcan G T 13: 89,841,056 (GRCm39) P1496Q probably damaging Het
Vmn1r192 G T 13: 22,371,845 (GRCm39) A125E probably damaging Het
Vti1b A T 12: 79,211,720 (GRCm39) probably null Het
Vwa3b A C 1: 37,163,126 (GRCm39) D583A probably damaging Het
Zfp638 T C 6: 83,953,254 (GRCm39) S1120P probably damaging Het
Zfyve26 A T 12: 79,315,409 (GRCm39) F1356I probably benign Het
Other mutations in Muc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Muc21 UTSW 17 35,933,525 (GRCm39) intron probably benign
FR4304:Muc21 UTSW 17 35,933,013 (GRCm39) intron probably benign
R0334:Muc21 UTSW 17 35,933,614 (GRCm39) intron probably benign
R0946:Muc21 UTSW 17 35,929,105 (GRCm39) missense probably benign 0.32
R1117:Muc21 UTSW 17 35,930,920 (GRCm39) intron probably benign
R1345:Muc21 UTSW 17 35,932,489 (GRCm39) intron probably benign
R1697:Muc21 UTSW 17 35,931,540 (GRCm39) intron probably benign
R1750:Muc21 UTSW 17 35,931,940 (GRCm39) intron probably benign
R1756:Muc21 UTSW 17 35,930,131 (GRCm39) intron probably benign
R1946:Muc21 UTSW 17 35,933,416 (GRCm39) intron probably benign
R1978:Muc21 UTSW 17 35,933,857 (GRCm39) intron probably benign
R1991:Muc21 UTSW 17 35,929,600 (GRCm39) missense probably benign 0.32
R1992:Muc21 UTSW 17 35,929,600 (GRCm39) missense probably benign 0.32
R2063:Muc21 UTSW 17 35,932,297 (GRCm39) intron probably benign
R2356:Muc21 UTSW 17 35,932,563 (GRCm39) intron probably benign
R2866:Muc21 UTSW 17 35,930,599 (GRCm39) intron probably benign
R3826:Muc21 UTSW 17 35,932,504 (GRCm39) intron probably benign
R4020:Muc21 UTSW 17 35,930,953 (GRCm39) intron probably benign
R4474:Muc21 UTSW 17 35,931,496 (GRCm39) intron probably benign
R4677:Muc21 UTSW 17 35,930,599 (GRCm39) intron probably benign
R4786:Muc21 UTSW 17 35,930,221 (GRCm39) intron probably benign
R5071:Muc21 UTSW 17 35,931,444 (GRCm39) intron probably benign
R5173:Muc21 UTSW 17 35,931,633 (GRCm39) intron probably benign
R5283:Muc21 UTSW 17 35,932,224 (GRCm39) intron probably benign
R5446:Muc21 UTSW 17 35,933,395 (GRCm39) intron probably benign
R5542:Muc21 UTSW 17 35,933,395 (GRCm39) intron probably benign
R5716:Muc21 UTSW 17 35,931,675 (GRCm39) intron probably benign
R5913:Muc21 UTSW 17 35,934,123 (GRCm39) intron probably benign
R6011:Muc21 UTSW 17 35,933,074 (GRCm39) intron probably benign
R6198:Muc21 UTSW 17 35,931,808 (GRCm39) intron probably benign
R6394:Muc21 UTSW 17 35,931,058 (GRCm39) intron probably benign
R6786:Muc21 UTSW 17 35,934,057 (GRCm39) intron probably benign
R6940:Muc21 UTSW 17 35,934,118 (GRCm39) intron probably benign
R7082:Muc21 UTSW 17 35,932,093 (GRCm39) missense unknown
R7103:Muc21 UTSW 17 35,932,432 (GRCm39) missense unknown
R7110:Muc21 UTSW 17 35,933,510 (GRCm39) intron probably benign
R7139:Muc21 UTSW 17 35,933,525 (GRCm39) intron probably benign
R7165:Muc21 UTSW 17 35,932,870 (GRCm39) missense unknown
R7200:Muc21 UTSW 17 35,933,525 (GRCm39) intron probably benign
R7204:Muc21 UTSW 17 35,932,105 (GRCm39) intron probably benign
R7289:Muc21 UTSW 17 35,929,761 (GRCm39) missense unknown
R7290:Muc21 UTSW 17 35,929,761 (GRCm39) missense unknown
R7295:Muc21 UTSW 17 35,929,761 (GRCm39) missense unknown
R7319:Muc21 UTSW 17 35,932,935 (GRCm39) intron probably benign
R7462:Muc21 UTSW 17 35,931,568 (GRCm39) missense unknown
R7529:Muc21 UTSW 17 35,930,123 (GRCm39) missense unknown
R7718:Muc21 UTSW 17 35,933,728 (GRCm39) missense unknown
R7788:Muc21 UTSW 17 35,929,798 (GRCm39) missense unknown
R7798:Muc21 UTSW 17 35,932,146 (GRCm39) missense unknown
R7831:Muc21 UTSW 17 35,929,651 (GRCm39) missense unknown
R7896:Muc21 UTSW 17 35,930,917 (GRCm39) missense unknown
R7899:Muc21 UTSW 17 35,931,493 (GRCm39) intron probably benign
R7932:Muc21 UTSW 17 35,933,525 (GRCm39) intron probably benign
R8025:Muc21 UTSW 17 35,931,879 (GRCm39) intron probably benign
R8077:Muc21 UTSW 17 35,930,628 (GRCm39) intron probably benign
R8090:Muc21 UTSW 17 35,932,617 (GRCm39) missense unknown
R8169:Muc21 UTSW 17 35,932,072 (GRCm39) missense unknown
R8184:Muc21 UTSW 17 35,933,722 (GRCm39) missense unknown
R8209:Muc21 UTSW 17 35,930,599 (GRCm39) intron probably benign
R8226:Muc21 UTSW 17 35,930,599 (GRCm39) intron probably benign
R8464:Muc21 UTSW 17 35,933,098 (GRCm39) intron probably benign
R8670:Muc21 UTSW 17 35,932,540 (GRCm39) missense unknown
R8783:Muc21 UTSW 17 35,930,875 (GRCm39) missense unknown
R8856:Muc21 UTSW 17 35,931,865 (GRCm39) missense unknown
R9155:Muc21 UTSW 17 35,932,131 (GRCm39) missense unknown
R9214:Muc21 UTSW 17 35,931,838 (GRCm39) missense unknown
R9353:Muc21 UTSW 17 35,930,545 (GRCm39) missense unknown
R9618:Muc21 UTSW 17 35,932,935 (GRCm39) intron probably benign
R9621:Muc21 UTSW 17 35,932,720 (GRCm39) missense unknown
R9679:Muc21 UTSW 17 35,930,491 (GRCm39) missense unknown
RF025:Muc21 UTSW 17 35,933,771 (GRCm39) intron probably benign
Z1176:Muc21 UTSW 17 35,932,137 (GRCm39) missense unknown
Z1177:Muc21 UTSW 17 35,931,951 (GRCm39) missense unknown
Z1177:Muc21 UTSW 17 35,931,817 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATAGATCCTGAGGCAGAGCTGG -3'
(R):5'- AGCACTGCCTCAAGATCTAC -3'

Sequencing Primer
(F):5'- CAGAGCTGGATGCAGTGGTG -3'
(R):5'- TCCTACCACCACTGCATCTAG -3'
Posted On 2019-11-26