Mutagenetix > Incidental Mutation

Incidental Mutation 'R7762:Csf1r'

597982

Institutional Source

Beutler Lab

Gene Symbol

Csf1r

Ensembl Gene

ENSMUSG00000024621

Gene Name

colony stimulating factor 1 receptor

Synonyms

Fms, Fim-2, CD115, M-CSFR, CSF-1R, Csfmr

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.911) question?

Stock #

R7762 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61105572-61132149 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 61110500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 196 (N196I)

Ref Sequence

ENSEMBL: ENSMUSP00000025523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000115268]

AlphaFold

P09581

Predicted Effect

probably benign
Transcript: ENSMUST00000025523
AA Change: N196I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: N196I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	27	102	4.63e-8	SMART
IG	112	196	7.82e-6	SMART
IGc2	215	285	1.36e-5	SMART
IG	308	397	3.2e-2	SMART
IG_like	402	504	1.8e2	SMART
transmembrane domain	513	535	N/A	INTRINSIC
TyrKc	580	908	1.45e-134	SMART
low complexity region	926	954	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115268
AA Change: N196I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: N196I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	27	102	4.63e-8	SMART
IG	112	196	7.82e-6	SMART
IGc2	215	285	1.36e-5	SMART
IG	308	397	3.2e-2	SMART
IG_like	402	504	1.8e2	SMART
transmembrane domain	513	535	N/A	INTRINSIC
TyrKc	580	908	1.45e-134	SMART
low complexity region	926	954	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	G	A	6: 48,932,686	V622I	probably benign	Het
9130011E15Rik	A	G	19: 45,940,443		probably null	Het
Acod1	T	G	14: 103,051,340	D95E	probably damaging	Het
Agpat4	A	G	17: 12,210,322	T154A	possibly damaging	Het
Ahnak2	A	T	12: 112,775,680	S653T	probably benign	Het
Aox2	C	T	1: 58,349,104	P1124S	probably damaging	Het
Atp4a	T	C	7: 30,720,036	I637T	probably damaging	Het
Atxn7	T	A	14: 14,100,467	C718S	probably damaging	Het
Btbd2	T	A	10: 80,643,556	I516F	probably damaging	Het
Card6	A	G	15: 5,105,338	S128P	probably benign	Het
Cat	T	C	2: 103,456,858	K476E	probably benign	Het
Ccr9	A	T	9: 123,779,957	T235S	probably benign	Het
Cep55	T	G	19: 38,069,069		probably null	Het
Clec2e	A	G	6: 129,095,128	F96S	possibly damaging	Het
Clk2	G	A	3: 89,167,191	V53I	probably benign	Het
Clnk	T	C	5: 38,768,141	M106V	probably benign	Het
Col6a5	T	C	9: 105,931,324	I842V	unknown	Het
D5Ertd579e	A	T	5: 36,613,381	N116K		Het
Dnaja4	A	G	9: 54,709,210	I166V	probably benign	Het
Dqx1	A	G	6: 83,061,032	E467G	probably damaging	Het
Dync2h1	T	C	9: 7,129,719	T1760A	probably benign	Het
Eea1	T	C	10: 96,028,439	V940A	probably benign	Het
Egr1	T	A	18: 34,863,545	V460E	probably damaging	Het
Eral1	A	G	11: 78,074,533	I352T	possibly damaging	Het
F2	T	C	2: 91,628,696	H476R	possibly damaging	Het
Fam83b	A	G	9: 76,492,432	V463A	possibly damaging	Het
Fat1	T	C	8: 45,023,322	S1802P	probably damaging	Het
Fat1	T	A	8: 45,037,337	L3762H	probably damaging	Het
Fibp	A	T	19: 5,464,174	N296Y	probably benign	Het
Figla	A	G	6: 86,017,326	M28V	probably benign	Het
Foxd3	C	A	4: 99,657,125	Y167*	probably null	Het
Gm17019	T	A	5: 15,030,992	H145L	probably benign	Het
Gm340	T	C	19: 41,583,667	L287S	probably benign	Het
Gm48552	C	T	10: 81,390,435	P18L	probably damaging	Het
Gm9573	G	A	17: 35,622,085	T403I	unknown	Het
H2-Q6	A	G	17: 35,428,101	N283S	probably benign	Het
Hrh2	T	A	13: 54,214,039	C11*	probably null	Het
Hrnr	G	T	3: 93,332,199	G3248V	unknown	Het
Iapp	C	A	6: 142,303,396	N58K	possibly damaging	Het
Itga5	T	C	15: 103,349,757	N837S	probably benign	Het
Klhl35	C	A	7: 99,468,440	H64N	probably benign	Het
Lrba	T	A	3: 86,532,201	V2015E	probably damaging	Het
Mdn1	T	C	4: 32,734,421	I3276T	probably benign	Het
Mlh3	G	T	12: 85,268,284	T376K	possibly damaging	Het
Nbea	A	T	3: 55,649,705	H2550Q	probably damaging	Het
Nid1	G	A	13: 13,489,045	G763D	probably damaging	Het
Ntf5	C	A	7: 45,415,819	A125E	probably damaging	Het
Obsl1	A	T	1: 75,503,523	C460S	probably benign	Het
Olfr1272	T	A	2: 90,296,631	K77*	probably null	Het
Olfr130	G	A	17: 38,067,675	C168Y	probably damaging	Het
Olfr1380	T	A	11: 49,564,761	I280N	possibly damaging	Het
Olfr1496	A	T	19: 13,781,286	R223W	probably damaging	Het
Olfr348	A	T	2: 36,787,010	I162F	probably benign	Het
Olfr820	A	G	10: 130,017,181		probably benign	Het
Olfr933	G	A	9: 38,976,194	V173I	probably benign	Het
Orai3	G	A	7: 127,773,571	G130S	unknown	Het
Pcdhb12	T	G	18: 37,435,924	V41G	probably damaging	Het
Plec	A	T	15: 76,183,623	L1194Q	unknown	Het
Pml	C	A	9: 58,220,173	C763F	probably damaging	Het
Prdm15	T	A	16: 97,818,273	I318F	probably benign	Het
Rcbtb2	C	A	14: 73,178,466	T473N	probably benign	Het
Sbno1	T	A	5: 124,374,666	I1347F	probably benign	Het
Secisbp2l	C	T	2: 125,768,193	D269N	probably damaging	Het
Serpina9	A	T	12: 104,001,316	F273L	probably damaging	Het
Sgms2	T	A	3: 131,323,249	Y319F	probably benign	Het
Sgo2b	A	T	8: 63,926,497	H1100Q	probably benign	Het
Sh3bp5l	A	T	11: 58,345,928		probably null	Het
Shh	T	G	5: 28,466,666	K33T	probably benign	Het
Slc5a9	A	G	4: 111,890,174	Y339H	probably damaging	Het
Spice1	T	A	16: 44,370,501		probably null	Het
Tbx2	A	G	11: 85,835,901	E257G	probably damaging	Het
Tenm2	G	A	11: 36,023,306	T2468I	possibly damaging	Het
Tmeff2	A	T	1: 50,979,416	N186Y	probably benign	Het
Tmem132c	T	C	5: 127,554,696	V673A	possibly damaging	Het
Trappc11	G	T	8: 47,522,376	T269K	probably damaging	Het
Trpc6	T	C	9: 8,653,149	F652S	possibly damaging	Het
Trpv1	G	T	11: 73,254,222	K711N	probably benign	Het
Vcan	G	T	13: 89,692,937	P1496Q	probably damaging	Het
Vmn1r192	G	T	13: 22,187,675	A125E	probably damaging	Het
Vti1b	A	T	12: 79,164,946		probably null	Het
Vwa3b	A	C	1: 37,124,045	D583A	probably damaging	Het
Zfp638	T	C	6: 83,976,272	S1120P	probably damaging	Het
Zfyve26	A	T	12: 79,268,635	F1356I	probably benign	Het

Other mutations in Csf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01403:Csf1r	APN	18	61114825	missense	probably benign	0.08
IGL01603:Csf1r	APN	18	61129301	missense	probably damaging	1.00
IGL02377:Csf1r	APN	18	61124468	splice site	probably benign
IGL03000:Csf1r	APN	18	61109652	missense	probably damaging	0.97
IGL03011:Csf1r	APN	18	61110401	missense	probably benign	0.00
IGL03132:Csf1r	APN	18	61128099	missense	probably benign	0.03
IGL03189:Csf1r	APN	18	61105986	missense	probably benign	0.05
IGL03224:Csf1r	APN	18	61112062	missense	probably damaging	0.96
IGL03351:Csf1r	APN	18	61117108	nonsense	probably null
ANU74:Csf1r	UTSW	18	61117391	missense	probably benign	0.09
R1245:Csf1r	UTSW	18	61114812	missense	probably benign
R1363:Csf1r	UTSW	18	61124845	missense	possibly damaging	0.95
R1651:Csf1r	UTSW	18	61110401	missense	possibly damaging	0.64
R1785:Csf1r	UTSW	18	61129077	missense	probably damaging	0.98
R1786:Csf1r	UTSW	18	61129077	missense	probably damaging	0.98
R1902:Csf1r	UTSW	18	61130141	missense	probably damaging	0.99
R1968:Csf1r	UTSW	18	61112795	missense	probably benign	0.00
R2177:Csf1r	UTSW	18	61114943	splice site	probably benign
R3743:Csf1r	UTSW	18	61114774	missense	probably benign	0.01
R3809:Csf1r	UTSW	18	61112764	missense	probably benign	0.22
R4374:Csf1r	UTSW	18	61119006	missense	probably damaging	0.99
R4683:Csf1r	UTSW	18	61124911	missense	probably damaging	1.00
R4973:Csf1r	UTSW	18	61129047	missense	probably damaging	1.00
R5080:Csf1r	UTSW	18	61124301	missense	probably damaging	1.00
R5314:Csf1r	UTSW	18	61129724	missense	probably damaging	1.00
R5936:Csf1r	UTSW	18	61125808	missense	probably damaging	1.00
R6015:Csf1r	UTSW	18	61109712	missense	possibly damaging	0.50
R6227:Csf1r	UTSW	18	61125828	nonsense	probably null
R6505:Csf1r	UTSW	18	61129733	missense	probably damaging	1.00
R6602:Csf1r	UTSW	18	61110425	missense	possibly damaging	0.81
R6811:Csf1r	UTSW	18	61119053	missense	probably damaging	1.00
R6813:Csf1r	UTSW	18	61112734	missense	probably benign
R7218:Csf1r	UTSW	18	61130324	missense	probably damaging	1.00
R7480:Csf1r	UTSW	18	61117538	missense	probably benign	0.06
R7752:Csf1r	UTSW	18	61110296	missense	probably damaging	1.00
R7901:Csf1r	UTSW	18	61110296	missense	probably damaging	1.00
R7953:Csf1r	UTSW	18	61124875	missense	probably damaging	1.00
R7986:Csf1r	UTSW	18	61114832	missense	probably benign	0.00
R8012:Csf1r	UTSW	18	61117064	missense	possibly damaging	0.86
R8043:Csf1r	UTSW	18	61124875	missense	probably damaging	1.00
R8296:Csf1r	UTSW	18	61117678	missense	probably damaging	1.00
R8355:Csf1r	UTSW	18	61128150	missense	probably damaging	1.00
R8371:Csf1r	UTSW	18	61117591	missense	probably benign	0.26
R8421:Csf1r	UTSW	18	61127894	missense	probably damaging	1.00
R8493:Csf1r	UTSW	18	61114882	missense	probably damaging	0.98
R8726:Csf1r	UTSW	18	61117656	missense	probably benign	0.17
R8786:Csf1r	UTSW	18	61114870	missense	probably damaging	0.98
R9262:Csf1r	UTSW	18	61110334	missense	probably benign	0.00
R9555:Csf1r	UTSW	18	61110401	missense	possibly damaging	0.64
R9627:Csf1r	UTSW	18	61127900	missense	probably damaging	1.00
R9778:Csf1r	UTSW	18	61127885	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGTGTCTCACTGATGCGTG -3'
(R):5'- TATAGAGGTCTCCCTACCGTGAG -3'

Sequencing Primer
(F):5'- CTCACTGATGCGTGAGGGG -3'
(R):5'- CGTGAGGATTTCTATGCCAAATGC -3'

Posted On

2019-11-26