Incidental Mutation 'R7763:Kif14'
ID597990
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Namekinesin family member 14
SynonymsN-3 kinesin, D1Ertd367e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R7763 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location136466343-136531511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136516383 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1371 (E1371G)
Ref Sequence ENSEMBL: ENSMUSP00000139698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]
PDB Structure
Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000047817
AA Change: E1321G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: E1321G

DomainStartEndE-ValueType
KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189413
AA Change: E1371G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: E1371G

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201676
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,514,602 W899R probably damaging Het
Abca5 A T 11: 110,272,497 W1631R possibly damaging Het
Actg2 T A 6: 83,527,368 D25V probably damaging Het
Akap10 G C 11: 61,915,505 D132E probably damaging Het
Angptl2 G T 2: 33,242,382 E334* probably null Het
Aprt T C 8: 122,574,935 R165G probably benign Het
B020004J07Rik T C 4: 101,837,141 I182V possibly damaging Het
Bmp1 A G 14: 70,492,084 F549S probably damaging Het
Capzb C T 4: 139,280,553 T215I probably benign Het
Car14 C T 3: 95,904,372 M1I probably null Het
Ccdc148 T A 2: 58,823,636 Q501L probably benign Het
Ccdc32 G A 2: 119,027,347 T12I probably damaging Het
Ccnf G A 17: 24,225,012 S594L probably damaging Het
Cdadc1 C T 14: 59,573,834 C409Y probably damaging Het
Cdh23 G T 10: 60,312,577 S2670R probably damaging Het
Cdh8 T A 8: 99,279,674 K94* probably null Het
Cdhr2 A T 13: 54,717,692 Y193F probably damaging Het
Cdon T A 9: 35,454,415 Y153* probably null Het
Chd1 G A 17: 15,733,041 G413R probably damaging Het
Cit A T 5: 115,987,001 T1582S probably benign Het
Clec4a3 T C 6: 122,964,340 L98P probably benign Het
Cpa4 T A 6: 30,583,645 D253E probably damaging Het
Cyhr1 A T 15: 76,658,547 Y138N probably damaging Het
Cyp2c40 T A 19: 39,807,168 N189I possibly damaging Het
Daam2 G T 17: 49,490,022 A245E probably benign Het
Dennd5b A G 6: 149,068,658 F121S probably damaging Het
Dgkd A G 1: 87,926,949 T658A probably benign Het
Dmwd T A 7: 19,080,340 L305Q probably damaging Het
Dnah5 A T 15: 28,313,855 Y1939F probably damaging Het
Dock5 T C 14: 67,821,327 T512A probably damaging Het
Dopey2 T A 16: 93,755,514 D398E probably benign Het
Eef1akmt4 A G 16: 20,618,529 H207R probably damaging Het
Egfr T C 11: 16,891,266 V719A probably damaging Het
Ep300 A T 15: 81,586,583 probably benign Het
Epha4 A G 1: 77,390,031 probably null Het
Erc2 T G 14: 27,876,204 probably null Het
Ergic1 A T 17: 26,638,827 Y209F possibly damaging Het
Fbxw28 A G 9: 109,326,633 I357T probably damaging Het
Flnb A T 14: 7,926,478 T1841S probably benign Het
Foxc1 G A 13: 31,808,028 S274N probably benign Het
Fto C T 8: 91,409,443 T115M probably damaging Het
Gm10228 C G 16: 89,041,299 C39S unknown Het
Gm7334 T C 17: 50,698,715 F10L possibly damaging Het
Hfm1 A G 5: 106,881,861 Y785H probably damaging Het
Hivep1 T A 13: 42,159,461 S1726T probably benign Het
Htt G T 5: 34,852,190 C1505F probably damaging Het
Hydin T C 8: 110,505,843 S1665P possibly damaging Het
Ifi209 T A 1: 173,642,879 N344K probably damaging Het
Ifnar2 T C 16: 91,399,293 M262T probably benign Het
Ighv7-3 T A 12: 114,153,207 S112C probably damaging Het
Igkv4-86 A G 6: 68,910,579 S59P probably benign Het
Iglv1 A G 16: 19,085,489 probably benign Het
Ipo7 T A 7: 110,052,799 D928E possibly damaging Het
Itgae G T 11: 73,123,269 probably null Het
Kbtbd12 T A 6: 88,618,197 Q217L probably benign Het
Kcnma1 T A 14: 23,300,006 Y1155F possibly damaging Het
Lilrb4a A T 10: 51,491,046 Y10F probably benign Het
Lrp2 A T 2: 69,503,388 V1503E probably damaging Het
Mfsd6 A T 1: 52,708,640 D355E probably benign Het
Mri1 T C 8: 84,251,028 H226R Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Muc4 T A 16: 32,753,311 L1063H probably benign Het
Mzf1 A T 7: 13,044,091 I541N probably damaging Het
Nasp T A 4: 116,612,033 E116D probably benign Het
Nlrp10 T A 7: 108,925,826 E149V probably damaging Het
Notch4 G A 17: 34,582,418 C1080Y probably damaging Het
Nova1 T G 12: 46,720,698 I147L unknown Het
Ogdh A G 11: 6,338,558 M223V probably benign Het
Olfr1391 G T 11: 49,327,671 A87S probably benign Het
Olfr444 T C 6: 42,955,789 I97T probably benign Het
Olfr732 A T 14: 50,281,488 I255N probably damaging Het
Olfr792 G T 10: 129,541,455 R306L probably benign Het
P3h3 T C 6: 124,854,432 Q330R probably benign Het
Pcdhb10 A G 18: 37,411,882 T4A not run Het
Pkd2l2 A T 18: 34,433,287 probably null Het
Plekhb1 C T 7: 100,645,663 V168I probably benign Het
Plxna4 C T 6: 32,223,980 R753H probably damaging Het
Prex1 G C 2: 166,713,709 P4A unknown Het
Ptgdr A G 14: 44,859,078 V59A probably damaging Het
Ralgapa1 T A 12: 55,757,955 I519F probably benign Het
Rbpms A G 8: 33,789,453 I170T probably benign Het
Sec31b T A 19: 44,523,835 probably null Het
Skint11 A T 4: 114,227,708 Y138F probably benign Het
Slain2 A G 5: 72,948,610 Y196C probably damaging Het
Slco1b2 T A 6: 141,676,224 C503* probably null Het
Slfn3 A T 11: 83,214,788 Y537F possibly damaging Het
Slu7 T C 11: 43,444,765 Y443H probably damaging Het
Sorl1 T A 9: 42,043,909 E683D probably damaging Het
Sos1 T A 17: 80,413,713 I893L probably benign Het
St8sia2 T A 7: 73,943,321 Y329F probably damaging Het
Stra6l C A 4: 45,869,570 S212* probably null Het
Syne3 C T 12: 104,997,495 probably benign Het
Tenm4 T A 7: 96,895,692 I2342N probably benign Het
Tescl T A 7: 24,333,263 E212D probably benign Het
Trip11 A G 12: 101,844,855 S1879P probably benign Het
Ube2c A T 2: 164,771,291 probably null Het
Umodl1 T A 17: 30,986,456 I675N probably benign Het
Vipr2 T C 12: 116,122,718 F121S probably damaging Het
Vmn1r206 A T 13: 22,620,669 S123T possibly damaging Het
Vmn1r58 A G 7: 5,410,913 V106A probably damaging Het
Vmn2r112 A G 17: 22,603,118 Y259C probably damaging Het
Vmn2r66 T C 7: 85,005,701 K467E probably benign Het
Vmn2r98 T C 17: 19,080,535 F600L probably benign Het
Vps13a T A 19: 16,746,000 N278I possibly damaging Het
Vwa5a A C 9: 38,741,162 D747A possibly damaging Het
Xdh G A 17: 73,934,834 P157S possibly damaging Het
Xrn1 G A 9: 95,998,348 probably null Het
Zfp362 T A 4: 128,787,031 H180L probably benign Het
Zfp560 A T 9: 20,347,323 W748R possibly damaging Het
Zfp808 A T 13: 62,172,664 Q569L probably benign Het
Zfp93 T A 7: 24,275,218 D209E possibly damaging Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00159:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00160:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00164:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00310:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00330:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00335:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00434:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00468:Kif14 APN 1 136469018 missense probably benign 0.11
IGL01330:Kif14 APN 1 136476374 missense probably damaging 0.99
IGL01530:Kif14 APN 1 136478419 splice site probably benign
IGL01622:Kif14 APN 1 136497356 splice site probably benign
IGL01689:Kif14 APN 1 136519642 missense probably damaging 0.99
IGL02115:Kif14 APN 1 136496567 splice site probably benign
IGL02252:Kif14 APN 1 136478392 missense probably damaging 1.00
IGL02259:Kif14 APN 1 136500102 missense probably benign
IGL02439:Kif14 APN 1 136490261 missense probably damaging 1.00
IGL02590:Kif14 APN 1 136496004 missense probably benign 0.00
IGL02606:Kif14 APN 1 136496593 missense probably damaging 1.00
IGL03253:Kif14 APN 1 136487460 missense probably damaging 0.97
R0106:Kif14 UTSW 1 136479924 splice site probably benign
R0193:Kif14 UTSW 1 136468438 missense probably benign 0.00
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0329:Kif14 UTSW 1 136496026 splice site probably benign
R0346:Kif14 UTSW 1 136468160 missense probably damaging 1.00
R0393:Kif14 UTSW 1 136482418 missense probably damaging 1.00
R0519:Kif14 UTSW 1 136469147 missense probably damaging 1.00
R0590:Kif14 UTSW 1 136482472 missense probably damaging 0.97
R0633:Kif14 UTSW 1 136527305 missense probably damaging 0.96
R0657:Kif14 UTSW 1 136469102 missense probably benign 0.07
R0831:Kif14 UTSW 1 136525871 splice site probably benign
R0971:Kif14 UTSW 1 136519654 missense probably damaging 0.98
R1018:Kif14 UTSW 1 136495841 splice site probably benign
R1520:Kif14 UTSW 1 136503324 missense probably benign 0.00
R1713:Kif14 UTSW 1 136527464 missense probably benign 0.00
R1728:Kif14 UTSW 1 136468279 missense probably benign
R1728:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1728:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1728:Kif14 UTSW 1 136490332 missense probably benign
R1728:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1728:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1728:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1729:Kif14 UTSW 1 136468279 missense probably benign
R1729:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1729:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1729:Kif14 UTSW 1 136490332 missense probably benign
R1729:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1729:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1729:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1730:Kif14 UTSW 1 136468279 missense probably benign
R1730:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1730:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1730:Kif14 UTSW 1 136490332 missense probably benign
R1730:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1730:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1730:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1739:Kif14 UTSW 1 136468279 missense probably benign
R1739:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1739:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1739:Kif14 UTSW 1 136490332 missense probably benign
R1739:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1739:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1739:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1762:Kif14 UTSW 1 136468279 missense probably benign
R1762:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1762:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1762:Kif14 UTSW 1 136490332 missense probably benign
R1762:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1762:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1762:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1783:Kif14 UTSW 1 136468279 missense probably benign
R1783:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1783:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1783:Kif14 UTSW 1 136490332 missense probably benign
R1783:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1783:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1783:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1784:Kif14 UTSW 1 136468279 missense probably benign
R1784:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1784:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1784:Kif14 UTSW 1 136490332 missense probably benign
R1784:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1784:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1784:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1785:Kif14 UTSW 1 136468279 missense probably benign
R1785:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1785:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1785:Kif14 UTSW 1 136490332 missense probably benign
R1785:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1785:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1785:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1872:Kif14 UTSW 1 136486358 missense probably damaging 1.00
R2049:Kif14 UTSW 1 136487080 missense probably benign
R2049:Kif14 UTSW 1 136510167 missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136519748 nonsense probably null
R2373:Kif14 UTSW 1 136479845 missense probably damaging 1.00
R3076:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136516363 nonsense probably null
R4246:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4247:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136521278 missense probably benign 0.00
R4672:Kif14 UTSW 1 136521279 missense probably benign
R4890:Kif14 UTSW 1 136487130 missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136482959 missense probably damaging 1.00
R5102:Kif14 UTSW 1 136516403 missense probably benign 0.00
R5185:Kif14 UTSW 1 136527469 nonsense probably null
R5201:Kif14 UTSW 1 136503407 missense probably benign 0.00
R5399:Kif14 UTSW 1 136503324 missense probably benign 0.00
R5431:Kif14 UTSW 1 136496695 missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136516390 missense probably benign 0.23
R6027:Kif14 UTSW 1 136483059 splice site probably null
R6246:Kif14 UTSW 1 136476424 nonsense probably null
R6331:Kif14 UTSW 1 136515986 missense probably null 1.00
R6448:Kif14 UTSW 1 136503347 missense probably damaging 0.99
R6453:Kif14 UTSW 1 136482304 splice site probably null
R6475:Kif14 UTSW 1 136527411 missense probably damaging 1.00
R6631:Kif14 UTSW 1 136515959 missense probably benign 0.39
R6713:Kif14 UTSW 1 136525806 missense probably benign
R7173:Kif14 UTSW 1 136479170 missense probably damaging 0.98
R7174:Kif14 UTSW 1 136521257 missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136468753 missense probably benign 0.41
R7674:Kif14 UTSW 1 136468820 missense probably damaging 0.99
R7688:Kif14 UTSW 1 136494654 missense probably damaging 1.00
R7711:Kif14 UTSW 1 136471453 missense probably benign 0.10
R7722:Kif14 UTSW 1 136468295 missense probably benign 0.00
R7882:Kif14 UTSW 1 136471576 critical splice donor site probably null
R7882:Kif14 UTSW 1 136516025 missense probably benign 0.43
R8077:Kif14 UTSW 1 136471448 missense possibly damaging 0.87
R8101:Kif14 UTSW 1 136476352 missense probably benign 0.14
R8308:Kif14 UTSW 1 136515913 missense possibly damaging 0.90
R8338:Kif14 UTSW 1 136494678 missense probably damaging 1.00
X0021:Kif14 UTSW 1 136490276 missense probably damaging 1.00
Z1176:Kif14 UTSW 1 136496653 missense probably damaging 0.97
Z1176:Kif14 UTSW 1 136500016 critical splice acceptor site probably null
Z1177:Kif14 UTSW 1 136478365 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTCGATGCTTCAATGGC -3'
(R):5'- AGTCTTAGGACCTCAAAACAGG -3'

Sequencing Primer
(F):5'- CGATGCTTCAATGGCAACTG -3'
(R):5'- TCTTAGGACCTCAAAACAGGAAGCAC -3'
Posted On2019-11-26