Mutagenetix > Incidental Mutation

Incidental Mutation 'R7763:Nasp'

598002

Institutional Source

Beutler Lab

Gene Symbol

Nasp

Ensembl Gene

ENSMUSG00000028693

Gene Name

nuclear autoantigenic sperm protein (histone-binding)

Synonyms

D4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116601052-116627941 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116612033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 116 (E116D)

Ref Sequence

ENSEMBL: ENSMUSP00000030456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000081182]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030456
AA Change: E116D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693
AA Change: E116D

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
TPR	43	76	8.51e0	SMART
low complexity region	111	126	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
low complexity region	336	352	N/A	INTRINSIC
low complexity region	455	478	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
TPR	528	561	3.05e0	SMART
TPR	570	603	2.38e-2	SMART
low complexity region	620	640	N/A	INTRINSIC
low complexity region	703	715	N/A	INTRINSIC
low complexity region	742	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000030457
AA Change: E116D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693
AA Change: E116D

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
TPR	43	76	8.51e0	SMART
low complexity region	111	126	N/A	INTRINSIC
low complexity region	133	153	N/A	INTRINSIC
low complexity region	167	178	N/A	INTRINSIC
TPR	203	236	3.05e0	SMART
TPR	245	278	2.38e-2	SMART
low complexity region	295	315	N/A	INTRINSIC
low complexity region	378	390	N/A	INTRINSIC
low complexity region	417	434	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081182
AA Change: E89D

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693
AA Change: E89D

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
TPR	43	76	6.2e-2	SMART
low complexity region	84	99	N/A	INTRINSIC
low complexity region	106	126	N/A	INTRINSIC
low complexity region	140	151	N/A	INTRINSIC
TPR	176	209	1.4e-2	SMART
TPR	218	251	1.1e-4	SMART
low complexity region	268	288	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
low complexity region	390	407	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,514,602	W899R	probably damaging	Het
Abca5	A	T	11: 110,272,497	W1631R	possibly damaging	Het
Actg2	T	A	6: 83,527,368	D25V	probably damaging	Het
Akap10	G	C	11: 61,915,505	D132E	probably damaging	Het
Angptl2	G	T	2: 33,242,382	E334*	probably null	Het
Aprt	T	C	8: 122,574,935	R165G	probably benign	Het
B020004J07Rik	T	C	4: 101,837,141	I182V	possibly damaging	Het
Bmp1	A	G	14: 70,492,084	F549S	probably damaging	Het
Capzb	C	T	4: 139,280,553	T215I	probably benign	Het
Car14	C	T	3: 95,904,372	M1I	probably null	Het
Ccdc148	T	A	2: 58,823,636	Q501L	probably benign	Het
Ccdc32	G	A	2: 119,027,347	T12I	probably damaging	Het
Ccnf	G	A	17: 24,225,012	S594L	probably damaging	Het
Cdadc1	C	T	14: 59,573,834	C409Y	probably damaging	Het
Cdh23	G	T	10: 60,312,577	S2670R	probably damaging	Het
Cdh8	T	A	8: 99,279,674	K94*	probably null	Het
Cdhr2	A	T	13: 54,717,692	Y193F	probably damaging	Het
Cdon	T	A	9: 35,454,415	Y153*	probably null	Het
Chd1	G	A	17: 15,733,041	G413R	probably damaging	Het
Cit	A	T	5: 115,987,001	T1582S	probably benign	Het
Clec4a3	T	C	6: 122,964,340	L98P	probably benign	Het
Cpa4	T	A	6: 30,583,645	D253E	probably damaging	Het
Cyhr1	A	T	15: 76,658,547	Y138N	probably damaging	Het
Cyp2c40	T	A	19: 39,807,168	N189I	possibly damaging	Het
Daam2	G	T	17: 49,490,022	A245E	probably benign	Het
Dennd5b	A	G	6: 149,068,658	F121S	probably damaging	Het
Dgkd	A	G	1: 87,926,949	T658A	probably benign	Het
Dmwd	T	A	7: 19,080,340	L305Q	probably damaging	Het
Dnah5	A	T	15: 28,313,855	Y1939F	probably damaging	Het
Dock5	T	C	14: 67,821,327	T512A	probably damaging	Het
Dopey2	T	A	16: 93,755,514	D398E	probably benign	Het
Eef1akmt4	A	G	16: 20,618,529	H207R	probably damaging	Het
Egfr	T	C	11: 16,891,266	V719A	probably damaging	Het
Ep300	A	T	15: 81,586,583		probably benign	Het
Epha4	A	G	1: 77,390,031		probably null	Het
Erc2	T	G	14: 27,876,204		probably null	Het
Ergic1	A	T	17: 26,638,827	Y209F	possibly damaging	Het
Fbxw28	A	G	9: 109,326,633	I357T	probably damaging	Het
Flnb	A	T	14: 7,926,478	T1841S	probably benign	Het
Foxc1	G	A	13: 31,808,028	S274N	probably benign	Het
Fto	C	T	8: 91,409,443	T115M	probably damaging	Het
Gm10228	C	G	16: 89,041,299	C39S	unknown	Het
Gm7334	T	C	17: 50,698,715	F10L	possibly damaging	Het
Hfm1	A	G	5: 106,881,861	Y785H	probably damaging	Het
Hivep1	T	A	13: 42,159,461	S1726T	probably benign	Het
Htt	G	T	5: 34,852,190	C1505F	probably damaging	Het
Hydin	T	C	8: 110,505,843	S1665P	possibly damaging	Het
Ifi209	T	A	1: 173,642,879	N344K	probably damaging	Het
Ifnar2	T	C	16: 91,399,293	M262T	probably benign	Het
Ighv7-3	T	A	12: 114,153,207	S112C	probably damaging	Het
Igkv4-86	A	G	6: 68,910,579	S59P	probably benign	Het
Iglv1	A	G	16: 19,085,489		probably benign	Het
Ipo7	T	A	7: 110,052,799	D928E	possibly damaging	Het
Itgae	G	T	11: 73,123,269		probably null	Het
Kbtbd12	T	A	6: 88,618,197	Q217L	probably benign	Het
Kcnma1	T	A	14: 23,300,006	Y1155F	possibly damaging	Het
Kif14	A	G	1: 136,516,383	E1371G	probably benign	Het
Lilrb4a	A	T	10: 51,491,046	Y10F	probably benign	Het
Lrp2	A	T	2: 69,503,388	V1503E	probably damaging	Het
Mfsd6	A	T	1: 52,708,640	D355E	probably benign	Het
Mri1	T	C	8: 84,251,028	H226R		Het
Mroh4	C	T	15: 74,624,705	E278K	probably damaging	Het
Muc4	T	A	16: 32,753,311	L1063H	probably benign	Het
Mzf1	A	T	7: 13,044,091	I541N	probably damaging	Het
Nlrp10	T	A	7: 108,925,826	E149V	probably damaging	Het
Notch4	G	A	17: 34,582,418	C1080Y	probably damaging	Het
Nova1	T	G	12: 46,720,698	I147L	unknown	Het
Ogdh	A	G	11: 6,338,558	M223V	probably benign	Het
Olfr1391	G	T	11: 49,327,671	A87S	probably benign	Het
Olfr444	T	C	6: 42,955,789	I97T	probably benign	Het
Olfr732	A	T	14: 50,281,488	I255N	probably damaging	Het
Olfr792	G	T	10: 129,541,455	R306L	probably benign	Het
P3h3	T	C	6: 124,854,432	Q330R	probably benign	Het
Pcdhb10	A	G	18: 37,411,882	T4A	not run	Het
Pkd2l2	A	T	18: 34,433,287		probably null	Het
Plekhb1	C	T	7: 100,645,663	V168I	probably benign	Het
Plxna4	C	T	6: 32,223,980	R753H	probably damaging	Het
Prex1	G	C	2: 166,713,709	P4A	unknown	Het
Ptgdr	A	G	14: 44,859,078	V59A	probably damaging	Het
Ralgapa1	T	A	12: 55,757,955	I519F	probably benign	Het
Rbpms	A	G	8: 33,789,453	I170T	probably benign	Het
Sec31b	T	A	19: 44,523,835		probably null	Het
Skint11	A	T	4: 114,227,708	Y138F	probably benign	Het
Slain2	A	G	5: 72,948,610	Y196C	probably damaging	Het
Slco1b2	T	A	6: 141,676,224	C503*	probably null	Het
Slfn3	A	T	11: 83,214,788	Y537F	possibly damaging	Het
Slu7	T	C	11: 43,444,765	Y443H	probably damaging	Het
Sorl1	T	A	9: 42,043,909	E683D	probably damaging	Het
Sos1	T	A	17: 80,413,713	I893L	probably benign	Het
St8sia2	T	A	7: 73,943,321	Y329F	probably damaging	Het
Stra6l	C	A	4: 45,869,570	S212*	probably null	Het
Syne3	C	T	12: 104,997,495		probably benign	Het
Tenm4	T	A	7: 96,895,692	I2342N	probably benign	Het
Tescl	T	A	7: 24,333,263	E212D	probably benign	Het
Trip11	A	G	12: 101,844,855	S1879P	probably benign	Het
Ube2c	A	T	2: 164,771,291		probably null	Het
Umodl1	T	A	17: 30,986,456	I675N	probably benign	Het
Vipr2	T	C	12: 116,122,718	F121S	probably damaging	Het
Vmn1r206	A	T	13: 22,620,669	S123T	possibly damaging	Het
Vmn1r58	A	G	7: 5,410,913	V106A	probably damaging	Het
Vmn2r112	A	G	17: 22,603,118	Y259C	probably damaging	Het
Vmn2r66	T	C	7: 85,005,701	K467E	probably benign	Het
Vmn2r98	T	C	17: 19,080,535	F600L	probably benign	Het
Vps13a	T	A	19: 16,746,000	N278I	possibly damaging	Het
Vwa5a	A	C	9: 38,741,162	D747A	possibly damaging	Het
Xdh	G	A	17: 73,934,834	P157S	possibly damaging	Het
Xrn1	G	A	9: 95,998,348		probably null	Het
Zfp362	T	A	4: 128,787,031	H180L	probably benign	Het
Zfp560	A	T	9: 20,347,323	W748R	possibly damaging	Het
Zfp808	A	T	13: 62,172,664	Q569L	probably benign	Het
Zfp93	T	A	7: 24,275,218	D209E	possibly damaging	Het

Other mutations in Nasp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Nasp	APN	4	116604219	missense	probably damaging	1.00
IGL00780:Nasp	APN	4	116603999	nonsense	probably null
IGL00833:Nasp	APN	4	116602736	missense	probably damaging	1.00
IGL02232:Nasp	APN	4	116604800	missense	probably damaging	0.99
R0023:Nasp	UTSW	4	116605771	splice site	probably benign
R0023:Nasp	UTSW	4	116605771	splice site	probably benign
R0179:Nasp	UTSW	4	116602157	missense	probably damaging	1.00
R0385:Nasp	UTSW	4	116610695	missense	probably benign	0.02
R1707:Nasp	UTSW	4	116618936	missense	probably damaging	0.99
R1945:Nasp	UTSW	4	116622768	missense	possibly damaging	0.62
R2061:Nasp	UTSW	4	116611126	missense	probably benign	0.12
R4983:Nasp	UTSW	4	116602185	missense	probably damaging	0.99
R5064:Nasp	UTSW	4	116611970	critical splice donor site	probably null
R5687:Nasp	UTSW	4	116605805	intron	probably benign
R5713:Nasp	UTSW	4	116614361	missense	probably benign	0.34
R5839:Nasp	UTSW	4	116602091	critical splice donor site	probably null
R6145:Nasp	UTSW	4	116611077	missense	probably benign	0.19
R6159:Nasp	UTSW	4	116603889	splice site	probably null
R6234:Nasp	UTSW	4	116622782	missense	possibly damaging	0.51
R6286:Nasp	UTSW	4	116604788	missense	probably damaging	1.00
R6483:Nasp	UTSW	4	116618948	missense	probably damaging	1.00
R6899:Nasp	UTSW	4	116604333	missense	probably damaging	1.00
R7276:Nasp	UTSW	4	116614349	missense	probably damaging	1.00
R7412:Nasp	UTSW	4	116610588	missense	possibly damaging	0.85
R8166:Nasp	UTSW	4	116610915	missense	probably benign	0.38
R8692:Nasp	UTSW	4	116612083	critical splice acceptor site	probably null
R9093:Nasp	UTSW	4	116610820	missense	probably benign	0.06
R9175:Nasp	UTSW	4	116614379	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCCCAAGTATCTTTGGAGAGACC -3'
(R):5'- ACTTCCCAGGGCCAGAATTC -3'

Sequencing Primer
(F):5'- TGGAGAGACCAACCACCATAAGG -3'
(R):5'- ACGGAAATCAGGTCCTCTTG -3'

Posted On

2019-11-26