Incidental Mutation 'R7763:Htt'
ID 598005
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Name huntingtin
Synonyms Hdh, huntingtin, HD, IT15, htt, C430023I11Rik
MMRRC Submission 045819-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 34919084-35069878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 35009534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1505 (C1505F)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080036
AA Change: C1505F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: C1505F

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,113,825 (GRCm39) W899R probably damaging Het
Abca5 A T 11: 110,163,323 (GRCm39) W1631R possibly damaging Het
Actg2 T A 6: 83,504,350 (GRCm39) D25V probably damaging Het
Akap10 G C 11: 61,806,331 (GRCm39) D132E probably damaging Het
Angptl2 G T 2: 33,132,394 (GRCm39) E334* probably null Het
Aprt T C 8: 123,301,674 (GRCm39) R165G probably benign Het
Bmp1 A G 14: 70,729,524 (GRCm39) F549S probably damaging Het
Capzb C T 4: 139,007,864 (GRCm39) T215I probably benign Het
Car14 C T 3: 95,811,684 (GRCm39) M1I probably null Het
Ccdc148 T A 2: 58,713,648 (GRCm39) Q501L probably benign Het
Ccdc32 G A 2: 118,857,828 (GRCm39) T12I probably damaging Het
Ccnf G A 17: 24,443,986 (GRCm39) S594L probably damaging Het
Cdadc1 C T 14: 59,811,283 (GRCm39) C409Y probably damaging Het
Cdh23 G T 10: 60,148,356 (GRCm39) S2670R probably damaging Het
Cdh8 T A 8: 100,006,306 (GRCm39) K94* probably null Het
Cdhr2 A T 13: 54,865,505 (GRCm39) Y193F probably damaging Het
Cdon T A 9: 35,365,711 (GRCm39) Y153* probably null Het
Chd1 G A 17: 15,953,303 (GRCm39) G413R probably damaging Het
Cit A T 5: 116,125,060 (GRCm39) T1582S probably benign Het
Clec4a3 T C 6: 122,941,299 (GRCm39) L98P probably benign Het
Cpa4 T A 6: 30,583,644 (GRCm39) D253E probably damaging Het
Cyp2c40 T A 19: 39,795,612 (GRCm39) N189I possibly damaging Het
Daam2 G T 17: 49,797,050 (GRCm39) A245E probably benign Het
Dennd5b A G 6: 148,970,156 (GRCm39) F121S probably damaging Het
Dgkd A G 1: 87,854,671 (GRCm39) T658A probably benign Het
Dmwd T A 7: 18,814,265 (GRCm39) L305Q probably damaging Het
Dnah5 A T 15: 28,314,001 (GRCm39) Y1939F probably damaging Het
Dock5 T C 14: 68,058,776 (GRCm39) T512A probably damaging Het
Dop1b T A 16: 93,552,402 (GRCm39) D398E probably benign Het
Eef1akmt4 A G 16: 20,437,279 (GRCm39) H207R probably damaging Het
Egfr T C 11: 16,841,266 (GRCm39) V719A probably damaging Het
Ep300 A T 15: 81,470,784 (GRCm39) probably benign Het
Epha4 A G 1: 77,366,668 (GRCm39) probably null Het
Erc2 T G 14: 27,598,161 (GRCm39) probably null Het
Ergic1 A T 17: 26,857,801 (GRCm39) Y209F possibly damaging Het
Fbxw28 A G 9: 109,155,701 (GRCm39) I357T probably damaging Het
Flnb A T 14: 7,926,478 (GRCm38) T1841S probably benign Het
Foxc1 G A 13: 31,992,011 (GRCm39) S274N probably benign Het
Fto C T 8: 92,136,071 (GRCm39) T115M probably damaging Het
Gm10228 C G 16: 88,838,187 (GRCm39) C39S unknown Het
Gm7334 T C 17: 51,005,743 (GRCm39) F10L possibly damaging Het
Hfm1 A G 5: 107,029,727 (GRCm39) Y785H probably damaging Het
Hivep1 T A 13: 42,312,937 (GRCm39) S1726T probably benign Het
Hydin T C 8: 111,232,475 (GRCm39) S1665P possibly damaging Het
Ifi209 T A 1: 173,470,445 (GRCm39) N344K probably damaging Het
Ifnar2 T C 16: 91,196,181 (GRCm39) M262T probably benign Het
Ighv7-3 T A 12: 114,116,827 (GRCm39) S112C probably damaging Het
Igkv4-86 A G 6: 68,887,563 (GRCm39) S59P probably benign Het
Iglv1 A G 16: 18,904,239 (GRCm39) probably benign Het
Ipo7 T A 7: 109,652,006 (GRCm39) D928E possibly damaging Het
Itgae G T 11: 73,014,095 (GRCm39) probably null Het
Kbtbd12 T A 6: 88,595,179 (GRCm39) Q217L probably benign Het
Kcnma1 T A 14: 23,350,074 (GRCm39) Y1155F possibly damaging Het
Kif14 A G 1: 136,444,121 (GRCm39) E1371G probably benign Het
Lilrb4a A T 10: 51,367,142 (GRCm39) Y10F probably benign Het
Lrp2 A T 2: 69,333,732 (GRCm39) V1503E probably damaging Het
Mfsd6 A T 1: 52,747,799 (GRCm39) D355E probably benign Het
Mri1 T C 8: 84,977,657 (GRCm39) H226R Het
Mroh4 C T 15: 74,496,554 (GRCm39) E278K probably damaging Het
Muc4 T A 16: 32,574,739 (GRCm39) L1063H probably benign Het
Mzf1 A T 7: 12,778,018 (GRCm39) I541N probably damaging Het
Nasp T A 4: 116,469,230 (GRCm39) E116D probably benign Het
Nlrp10 T A 7: 108,525,033 (GRCm39) E149V probably damaging Het
Notch4 G A 17: 34,801,392 (GRCm39) C1080Y probably damaging Het
Nova1 T G 12: 46,767,481 (GRCm39) I147L unknown Het
Ogdh A G 11: 6,288,558 (GRCm39) M223V probably benign Het
Or2a56 T C 6: 42,932,723 (GRCm39) I97T probably benign Het
Or2y1e G T 11: 49,218,498 (GRCm39) A87S probably benign Het
Or4n4 A T 14: 50,518,945 (GRCm39) I255N probably damaging Het
Or6c66b G T 10: 129,377,324 (GRCm39) R306L probably benign Het
P3h3 T C 6: 124,831,395 (GRCm39) Q330R probably benign Het
Pcdhb10 A G 18: 37,544,935 (GRCm39) T4A not run Het
Pkd2l2 A T 18: 34,566,340 (GRCm39) probably null Het
Plekhb1 C T 7: 100,294,870 (GRCm39) V168I probably benign Het
Plxna4 C T 6: 32,200,915 (GRCm39) R753H probably damaging Het
Pramel17 T C 4: 101,694,338 (GRCm39) I182V possibly damaging Het
Prex1 G C 2: 166,555,629 (GRCm39) P4A unknown Het
Ptgdr A G 14: 45,096,535 (GRCm39) V59A probably damaging Het
Ralgapa1 T A 12: 55,804,740 (GRCm39) I519F probably benign Het
Rbpms A G 8: 34,279,481 (GRCm39) I170T probably benign Het
Sec31b T A 19: 44,512,274 (GRCm39) probably null Het
Skint11 A T 4: 114,084,905 (GRCm39) Y138F probably benign Het
Slain2 A G 5: 73,105,953 (GRCm39) Y196C probably damaging Het
Slco1b2 T A 6: 141,621,950 (GRCm39) C503* probably null Het
Slfn3 A T 11: 83,105,614 (GRCm39) Y537F possibly damaging Het
Slu7 T C 11: 43,335,592 (GRCm39) Y443H probably damaging Het
Sorl1 T A 9: 41,955,205 (GRCm39) E683D probably damaging Het
Sos1 T A 17: 80,721,142 (GRCm39) I893L probably benign Het
St8sia2 T A 7: 73,593,069 (GRCm39) Y329F probably damaging Het
Stra6l C A 4: 45,869,570 (GRCm39) S212* probably null Het
Syne3 C T 12: 104,963,754 (GRCm39) probably benign Het
Tenm4 T A 7: 96,544,899 (GRCm39) I2342N probably benign Het
Tescl T A 7: 24,032,688 (GRCm39) E212D probably benign Het
Trip11 A G 12: 101,811,114 (GRCm39) S1879P probably benign Het
Ube2c A T 2: 164,613,211 (GRCm39) probably null Het
Umodl1 T A 17: 31,205,430 (GRCm39) I675N probably benign Het
Vipr2 T C 12: 116,086,338 (GRCm39) F121S probably damaging Het
Vmn1r206 A T 13: 22,804,839 (GRCm39) S123T possibly damaging Het
Vmn1r58 A G 7: 5,413,912 (GRCm39) V106A probably damaging Het
Vmn2r112 A G 17: 22,822,099 (GRCm39) Y259C probably damaging Het
Vmn2r66 T C 7: 84,654,909 (GRCm39) K467E probably benign Het
Vmn2r98 T C 17: 19,300,797 (GRCm39) F600L probably benign Het
Vps13a T A 19: 16,723,364 (GRCm39) N278I possibly damaging Het
Vwa5a A C 9: 38,652,458 (GRCm39) D747A possibly damaging Het
Xdh G A 17: 74,241,829 (GRCm39) P157S possibly damaging Het
Xrn1 G A 9: 95,880,401 (GRCm39) probably null Het
Zfp362 T A 4: 128,680,824 (GRCm39) H180L probably benign Het
Zfp560 A T 9: 20,258,619 (GRCm39) W748R possibly damaging Het
Zfp808 A T 13: 62,320,478 (GRCm39) Q569L probably benign Het
Zfp93 T A 7: 23,974,643 (GRCm39) D209E possibly damaging Het
Zftraf1 A T 15: 76,542,747 (GRCm39) Y138N probably damaging Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34,956,752 (GRCm39) missense probably benign 0.00
IGL00233:Htt APN 5 35,053,370 (GRCm39) splice site probably null
IGL00559:Htt APN 5 35,006,448 (GRCm39) splice site probably benign
IGL00765:Htt APN 5 35,034,769 (GRCm39) splice site probably benign
IGL00950:Htt APN 5 35,048,785 (GRCm39) missense probably benign
IGL00953:Htt APN 5 34,976,021 (GRCm39) missense probably benign 0.04
IGL00957:Htt APN 5 34,964,068 (GRCm39) missense probably benign
IGL01314:Htt APN 5 35,036,200 (GRCm39) missense probably benign
IGL01412:Htt APN 5 35,055,916 (GRCm39) missense probably damaging 0.98
IGL01510:Htt APN 5 35,064,856 (GRCm39) missense probably damaging 1.00
IGL01617:Htt APN 5 35,034,099 (GRCm39) missense possibly damaging 0.67
IGL01893:Htt APN 5 35,034,174 (GRCm39) missense probably damaging 1.00
IGL01914:Htt APN 5 34,987,053 (GRCm39) missense probably benign
IGL01994:Htt APN 5 34,989,948 (GRCm39) missense possibly damaging 0.83
IGL02102:Htt APN 5 35,048,825 (GRCm39) splice site probably benign
IGL02381:Htt APN 5 34,987,104 (GRCm39) missense probably benign 0.03
IGL02529:Htt APN 5 34,976,387 (GRCm39) splice site probably benign
IGL02678:Htt APN 5 35,057,246 (GRCm39) missense probably damaging 1.00
IGL02707:Htt APN 5 34,987,225 (GRCm39) critical splice donor site probably null
IGL02731:Htt APN 5 34,961,137 (GRCm39) missense probably benign 0.41
IGL02931:Htt APN 5 35,034,097 (GRCm39) missense probably damaging 1.00
IGL03167:Htt APN 5 34,976,330 (GRCm39) missense probably damaging 0.98
IGL03343:Htt APN 5 34,983,385 (GRCm39) missense probably benign
IGL03344:Htt APN 5 35,037,172 (GRCm39) missense probably benign 0.39
IGL03344:Htt APN 5 35,064,810 (GRCm39) missense probably benign 0.02
IGL03366:Htt APN 5 35,064,924 (GRCm39) missense probably damaging 1.00
IGL03410:Htt APN 5 34,956,789 (GRCm39) missense probably damaging 0.99
Chalk UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
IGL02796:Htt UTSW 5 35,034,826 (GRCm39) missense probably benign 0.43
PIT4377001:Htt UTSW 5 35,033,309 (GRCm39) missense probably benign 0.10
R0013:Htt UTSW 5 34,977,448 (GRCm39) missense probably benign 0.25
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0056:Htt UTSW 5 34,983,422 (GRCm39) splice site probably benign
R0207:Htt UTSW 5 35,054,252 (GRCm39) missense probably benign 0.11
R0329:Htt UTSW 5 34,974,478 (GRCm39) splice site probably benign
R0494:Htt UTSW 5 34,979,188 (GRCm39) missense possibly damaging 0.73
R0548:Htt UTSW 5 35,028,090 (GRCm39) missense probably damaging 1.00
R0601:Htt UTSW 5 35,003,347 (GRCm39) missense probably benign 0.08
R0799:Htt UTSW 5 34,975,097 (GRCm39) missense probably benign 0.00
R0947:Htt UTSW 5 35,056,268 (GRCm39) missense probably damaging 1.00
R1053:Htt UTSW 5 35,008,561 (GRCm39) critical splice acceptor site probably null
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1478:Htt UTSW 5 34,961,171 (GRCm39) missense probably damaging 0.99
R1573:Htt UTSW 5 35,021,718 (GRCm39) splice site probably benign
R1677:Htt UTSW 5 34,985,918 (GRCm39) missense probably damaging 1.00
R1792:Htt UTSW 5 35,064,543 (GRCm39) missense probably damaging 1.00
R1816:Htt UTSW 5 34,961,084 (GRCm39) missense probably benign 0.01
R1833:Htt UTSW 5 35,063,092 (GRCm39) splice site probably benign
R1837:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R1846:Htt UTSW 5 35,006,288 (GRCm39) missense probably damaging 0.98
R1875:Htt UTSW 5 34,951,456 (GRCm39) missense probably benign 0.05
R1899:Htt UTSW 5 35,064,429 (GRCm39) missense probably benign 0.01
R2013:Htt UTSW 5 35,010,215 (GRCm39) missense probably damaging 0.99
R2062:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2064:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2067:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2068:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2131:Htt UTSW 5 35,034,453 (GRCm39) missense possibly damaging 0.50
R2162:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R2169:Htt UTSW 5 35,034,819 (GRCm39) missense probably benign 0.08
R2345:Htt UTSW 5 34,983,348 (GRCm39) missense possibly damaging 0.80
R2433:Htt UTSW 5 35,064,885 (GRCm39) missense possibly damaging 0.65
R3027:Htt UTSW 5 34,977,439 (GRCm39) missense possibly damaging 0.85
R3123:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3125:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3717:Htt UTSW 5 34,968,866 (GRCm39) splice site probably benign
R3758:Htt UTSW 5 35,053,314 (GRCm39) missense probably damaging 0.97
R3805:Htt UTSW 5 35,034,548 (GRCm39) splice site probably null
R3833:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R4066:Htt UTSW 5 35,036,191 (GRCm39) missense probably benign
R4272:Htt UTSW 5 35,006,413 (GRCm39) missense possibly damaging 0.96
R4625:Htt UTSW 5 34,987,129 (GRCm39) missense probably damaging 0.99
R4634:Htt UTSW 5 35,033,292 (GRCm39) missense probably benign 0.06
R4655:Htt UTSW 5 35,063,476 (GRCm39) missense probably benign 0.06
R4679:Htt UTSW 5 34,977,424 (GRCm39) missense probably benign
R4684:Htt UTSW 5 35,010,109 (GRCm39) missense probably damaging 1.00
R4832:Htt UTSW 5 34,982,184 (GRCm39) missense probably benign 0.01
R4833:Htt UTSW 5 35,009,569 (GRCm39) missense probably damaging 0.98
R4973:Htt UTSW 5 34,970,367 (GRCm39) missense probably damaging 0.99
R5095:Htt UTSW 5 34,981,739 (GRCm39) missense possibly damaging 0.89
R5132:Htt UTSW 5 35,063,023 (GRCm39) missense possibly damaging 0.89
R5351:Htt UTSW 5 34,961,177 (GRCm39) missense probably damaging 0.99
R5361:Htt UTSW 5 35,064,928 (GRCm39) missense possibly damaging 0.47
R5399:Htt UTSW 5 35,034,495 (GRCm39) missense probably damaging 0.98
R5462:Htt UTSW 5 35,042,851 (GRCm39) nonsense probably null
R5552:Htt UTSW 5 34,979,118 (GRCm39) missense probably benign
R5566:Htt UTSW 5 35,006,419 (GRCm39) missense probably damaging 1.00
R5595:Htt UTSW 5 35,062,741 (GRCm39) missense probably damaging 0.96
R5617:Htt UTSW 5 35,028,150 (GRCm39) missense possibly damaging 0.77
R5835:Htt UTSW 5 34,970,534 (GRCm39) missense probably benign 0.16
R5891:Htt UTSW 5 35,028,167 (GRCm39) missense possibly damaging 0.62
R6158:Htt UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
R6159:Htt UTSW 5 34,962,020 (GRCm39) missense probably benign 0.08
R6169:Htt UTSW 5 35,064,817 (GRCm39) missense probably damaging 1.00
R6242:Htt UTSW 5 35,003,356 (GRCm39) missense probably damaging 1.00
R6274:Htt UTSW 5 35,009,431 (GRCm39) missense possibly damaging 0.81
R6280:Htt UTSW 5 35,028,103 (GRCm39) missense probably benign 0.00
R6294:Htt UTSW 5 34,979,170 (GRCm39) missense probably benign
R6331:Htt UTSW 5 35,053,231 (GRCm39) missense possibly damaging 0.89
R6448:Htt UTSW 5 35,033,336 (GRCm39) missense probably benign 0.05
R6474:Htt UTSW 5 34,982,239 (GRCm39) missense probably benign 0.06
R6592:Htt UTSW 5 35,034,388 (GRCm39) missense possibly damaging 0.92
R6818:Htt UTSW 5 34,940,111 (GRCm39) missense probably damaging 0.99
R6830:Htt UTSW 5 34,991,670 (GRCm39) missense possibly damaging 0.82
R6920:Htt UTSW 5 35,034,444 (GRCm39) missense probably null 1.00
R6962:Htt UTSW 5 35,057,115 (GRCm39) critical splice acceptor site probably null
R7057:Htt UTSW 5 34,979,067 (GRCm39) missense probably null 0.05
R7144:Htt UTSW 5 35,003,350 (GRCm39) missense probably damaging 1.00
R7166:Htt UTSW 5 35,010,238 (GRCm39) missense probably benign 0.42
R7329:Htt UTSW 5 34,987,099 (GRCm39) missense probably benign 0.03
R7378:Htt UTSW 5 34,961,143 (GRCm39) missense probably benign 0.04
R7418:Htt UTSW 5 34,947,697 (GRCm39) missense possibly damaging 0.55
R7495:Htt UTSW 5 34,968,821 (GRCm39) missense probably benign 0.00
R7554:Htt UTSW 5 35,022,084 (GRCm39) missense probably damaging 0.97
R7575:Htt UTSW 5 35,062,987 (GRCm39) missense probably damaging 1.00
R7782:Htt UTSW 5 35,040,336 (GRCm39) missense probably benign 0.03
R7850:Htt UTSW 5 35,009,631 (GRCm39) splice site probably null
R7870:Htt UTSW 5 35,055,891 (GRCm39) missense possibly damaging 0.77
R7871:Htt UTSW 5 35,021,993 (GRCm39) missense probably benign 0.00
R7879:Htt UTSW 5 34,981,252 (GRCm39) missense probably benign
R7992:Htt UTSW 5 34,987,225 (GRCm39) critical splice donor site probably null
R8058:Htt UTSW 5 34,977,444 (GRCm39) missense probably benign
R8168:Htt UTSW 5 35,040,300 (GRCm39) missense probably benign 0.00
R8188:Htt UTSW 5 34,919,287 (GRCm39) missense probably benign 0.03
R8262:Htt UTSW 5 35,053,304 (GRCm39) missense probably benign
R8343:Htt UTSW 5 35,063,068 (GRCm39) missense probably damaging 1.00
R8353:Htt UTSW 5 35,034,499 (GRCm39) missense possibly damaging 0.49
R8769:Htt UTSW 5 34,977,633 (GRCm39) missense probably benign 0.05
R8808:Htt UTSW 5 35,046,791 (GRCm39) missense probably benign 0.10
R8825:Htt UTSW 5 34,983,304 (GRCm39) missense probably benign 0.24
R8843:Htt UTSW 5 35,046,809 (GRCm39) missense possibly damaging 0.92
R8856:Htt UTSW 5 35,060,675 (GRCm39) missense probably benign 0.44
R8882:Htt UTSW 5 34,979,061 (GRCm39) missense probably benign
R8898:Htt UTSW 5 34,976,376 (GRCm39) missense probably benign 0.01
R8964:Htt UTSW 5 35,062,720 (GRCm39) missense probably benign 0.09
R8987:Htt UTSW 5 34,977,368 (GRCm39) missense probably benign 0.18
R8991:Htt UTSW 5 35,063,062 (GRCm39) missense probably damaging 1.00
R9005:Htt UTSW 5 34,975,095 (GRCm39) missense possibly damaging 0.92
R9019:Htt UTSW 5 35,023,920 (GRCm39) missense probably damaging 1.00
R9057:Htt UTSW 5 35,009,454 (GRCm39) missense possibly damaging 0.86
R9157:Htt UTSW 5 34,987,171 (GRCm39) missense probably null 0.89
R9205:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R9223:Htt UTSW 5 35,062,692 (GRCm39) missense probably benign 0.01
R9243:Htt UTSW 5 35,056,276 (GRCm39) splice site probably benign
R9329:Htt UTSW 5 34,989,957 (GRCm39) missense possibly damaging 0.69
R9355:Htt UTSW 5 35,053,247 (GRCm39) missense probably benign
R9402:Htt UTSW 5 35,006,324 (GRCm39) missense probably damaging 1.00
R9446:Htt UTSW 5 34,919,272 (GRCm39) missense probably benign
R9716:Htt UTSW 5 35,012,019 (GRCm39) missense probably damaging 1.00
Z1177:Htt UTSW 5 35,009,575 (GRCm39) missense probably null 0.87
Predicted Primers PCR Primer
(F):5'- TCTCCTGGGCTTGACTTGTAAC -3'
(R):5'- AGATCTGAGCCTATGCCCTC -3'

Sequencing Primer
(F):5'- CTAGGGAATCAGAGGCAATT -3'
(R):5'- AAAAGACCAAAGCAAATAAAGATGG -3'
Posted On 2019-11-26