Incidental Mutation 'R7763:Plxna4'
ID598010
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R7763 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32223980 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 753 (R753H)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: R753H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: R753H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,514,602 W899R probably damaging Het
Abca5 A T 11: 110,272,497 W1631R possibly damaging Het
Actg2 T A 6: 83,527,368 D25V probably damaging Het
Akap10 G C 11: 61,915,505 D132E probably damaging Het
Angptl2 G T 2: 33,242,382 E334* probably null Het
Aprt T C 8: 122,574,935 R165G probably benign Het
B020004J07Rik T C 4: 101,837,141 I182V possibly damaging Het
Bmp1 A G 14: 70,492,084 F549S probably damaging Het
Capzb C T 4: 139,280,553 T215I probably benign Het
Car14 C T 3: 95,904,372 M1I probably null Het
Ccdc148 T A 2: 58,823,636 Q501L probably benign Het
Ccdc32 G A 2: 119,027,347 T12I probably damaging Het
Ccnf G A 17: 24,225,012 S594L probably damaging Het
Cdadc1 C T 14: 59,573,834 C409Y probably damaging Het
Cdh23 G T 10: 60,312,577 S2670R probably damaging Het
Cdh8 T A 8: 99,279,674 K94* probably null Het
Cdhr2 A T 13: 54,717,692 Y193F probably damaging Het
Cdon T A 9: 35,454,415 Y153* probably null Het
Chd1 G A 17: 15,733,041 G413R probably damaging Het
Cit A T 5: 115,987,001 T1582S probably benign Het
Clec4a3 T C 6: 122,964,340 L98P probably benign Het
Cpa4 T A 6: 30,583,645 D253E probably damaging Het
Cyhr1 A T 15: 76,658,547 Y138N probably damaging Het
Cyp2c40 T A 19: 39,807,168 N189I possibly damaging Het
Daam2 G T 17: 49,490,022 A245E probably benign Het
Dennd5b A G 6: 149,068,658 F121S probably damaging Het
Dgkd A G 1: 87,926,949 T658A probably benign Het
Dmwd T A 7: 19,080,340 L305Q probably damaging Het
Dnah5 A T 15: 28,313,855 Y1939F probably damaging Het
Dock5 T C 14: 67,821,327 T512A probably damaging Het
Dopey2 T A 16: 93,755,514 D398E probably benign Het
Eef1akmt4 A G 16: 20,618,529 H207R probably damaging Het
Egfr T C 11: 16,891,266 V719A probably damaging Het
Ep300 A T 15: 81,586,583 probably benign Het
Epha4 A G 1: 77,390,031 probably null Het
Erc2 T G 14: 27,876,204 probably null Het
Ergic1 A T 17: 26,638,827 Y209F possibly damaging Het
Fbxw28 A G 9: 109,326,633 I357T probably damaging Het
Flnb A T 14: 7,926,478 T1841S probably benign Het
Foxc1 G A 13: 31,808,028 S274N probably benign Het
Fto C T 8: 91,409,443 T115M probably damaging Het
Gm10228 C G 16: 89,041,299 C39S unknown Het
Gm7334 T C 17: 50,698,715 F10L possibly damaging Het
Hfm1 A G 5: 106,881,861 Y785H probably damaging Het
Hivep1 T A 13: 42,159,461 S1726T probably benign Het
Htt G T 5: 34,852,190 C1505F probably damaging Het
Hydin T C 8: 110,505,843 S1665P possibly damaging Het
Ifi209 T A 1: 173,642,879 N344K probably damaging Het
Ifnar2 T C 16: 91,399,293 M262T probably benign Het
Ighv7-3 T A 12: 114,153,207 S112C probably damaging Het
Igkv4-86 A G 6: 68,910,579 S59P probably benign Het
Iglv1 A G 16: 19,085,489 probably benign Het
Ipo7 T A 7: 110,052,799 D928E possibly damaging Het
Itgae G T 11: 73,123,269 probably null Het
Kbtbd12 T A 6: 88,618,197 Q217L probably benign Het
Kcnma1 T A 14: 23,300,006 Y1155F possibly damaging Het
Kif14 A G 1: 136,516,383 E1371G probably benign Het
Lilrb4a A T 10: 51,491,046 Y10F probably benign Het
Lrp2 A T 2: 69,503,388 V1503E probably damaging Het
Mfsd6 A T 1: 52,708,640 D355E probably benign Het
Mri1 T C 8: 84,251,028 H226R Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Muc4 T A 16: 32,753,311 L1063H probably benign Het
Mzf1 A T 7: 13,044,091 I541N probably damaging Het
Nasp T A 4: 116,612,033 E116D probably benign Het
Nlrp10 T A 7: 108,925,826 E149V probably damaging Het
Notch4 G A 17: 34,582,418 C1080Y probably damaging Het
Nova1 T G 12: 46,720,698 I147L unknown Het
Ogdh A G 11: 6,338,558 M223V probably benign Het
Olfr1391 G T 11: 49,327,671 A87S probably benign Het
Olfr444 T C 6: 42,955,789 I97T probably benign Het
Olfr732 A T 14: 50,281,488 I255N probably damaging Het
Olfr792 G T 10: 129,541,455 R306L probably benign Het
P3h3 T C 6: 124,854,432 Q330R probably benign Het
Pcdhb10 A G 18: 37,411,882 T4A not run Het
Pkd2l2 A T 18: 34,433,287 probably null Het
Plekhb1 C T 7: 100,645,663 V168I probably benign Het
Prex1 G C 2: 166,713,709 P4A unknown Het
Ptgdr A G 14: 44,859,078 V59A probably damaging Het
Ralgapa1 T A 12: 55,757,955 I519F probably benign Het
Rbpms A G 8: 33,789,453 I170T probably benign Het
Sec31b T A 19: 44,523,835 probably null Het
Skint11 A T 4: 114,227,708 Y138F probably benign Het
Slain2 A G 5: 72,948,610 Y196C probably damaging Het
Slco1b2 T A 6: 141,676,224 C503* probably null Het
Slfn3 A T 11: 83,214,788 Y537F possibly damaging Het
Slu7 T C 11: 43,444,765 Y443H probably damaging Het
Sorl1 T A 9: 42,043,909 E683D probably damaging Het
Sos1 T A 17: 80,413,713 I893L probably benign Het
St8sia2 T A 7: 73,943,321 Y329F probably damaging Het
Stra6l C A 4: 45,869,570 S212* probably null Het
Syne3 C T 12: 104,997,495 probably benign Het
Tenm4 T A 7: 96,895,692 I2342N probably benign Het
Tescl T A 7: 24,333,263 E212D probably benign Het
Trip11 A G 12: 101,844,855 S1879P probably benign Het
Ube2c A T 2: 164,771,291 probably null Het
Umodl1 T A 17: 30,986,456 I675N probably benign Het
Vipr2 T C 12: 116,122,718 F121S probably damaging Het
Vmn1r206 A T 13: 22,620,669 S123T possibly damaging Het
Vmn1r58 A G 7: 5,410,913 V106A probably damaging Het
Vmn2r112 A G 17: 22,603,118 Y259C probably damaging Het
Vmn2r66 T C 7: 85,005,701 K467E probably benign Het
Vmn2r98 T C 17: 19,080,535 F600L probably benign Het
Vps13a T A 19: 16,746,000 N278I possibly damaging Het
Vwa5a A C 9: 38,741,162 D747A possibly damaging Het
Xdh G A 17: 73,934,834 P157S possibly damaging Het
Xrn1 G A 9: 95,998,348 probably null Het
Zfp362 T A 4: 128,787,031 H180L probably benign Het
Zfp560 A T 9: 20,347,323 W748R possibly damaging Het
Zfp808 A T 13: 62,172,664 Q569L probably benign Het
Zfp93 T A 7: 24,275,218 D209E possibly damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
corona UTSW 6 32517264 missense probably damaging 1.00
inclined UTSW 6 32237723 nonsense probably null
Slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 splice site probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32196122 critical splice donor site probably null
R7383:Plxna4 UTSW 6 32152799 critical splice donor site probably null
R7405:Plxna4 UTSW 6 32196319 missense probably benign 0.00
R7516:Plxna4 UTSW 6 32237768 missense probably benign 0.00
R7635:Plxna4 UTSW 6 32496741 missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32152872 missense probably damaging 1.00
R7789:Plxna4 UTSW 6 32206233 critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32517046 missense probably damaging 0.99
R8191:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R8225:Plxna4 UTSW 6 32162103 missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32152854 missense probably benign 0.25
R8305:Plxna4 UTSW 6 32211065 missense possibly damaging 0.81
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGGCTACAATCAGAGTTCACAG -3'
(R):5'- AAGCTGAGCCATGCCTTCTG -3'

Sequencing Primer
(F):5'- CTACAATCAGAGTTCACAGCTAGTAG -3'
(R):5'- ATGCCTTCTGTCCCCAGG -3'
Posted On2019-11-26