Incidental Mutation 'R7763:Xrn1'
ID598041
Institutional Source Beutler Lab
Gene Symbol Xrn1
Ensembl Gene ENSMUSG00000032410
Gene Name5'-3' exoribonuclease 1
SynonymsDhm2, mXrn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R7763 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location95954760-96057803 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 95998348 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034981] [ENSMUST00000185633] [ENSMUST00000190665]
Predicted Effect probably null
Transcript: ENSMUST00000034981
SMART Domains Protein: ENSMUSP00000034981
Gene: ENSMUSG00000032410

DomainStartEndE-ValueType
Pfam:XRN_N 1 227 8.4e-99 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1665 1684 N/A INTRINSIC
low complexity region 1696 1711 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185633
SMART Domains Protein: ENSMUSP00000140278
Gene: ENSMUSG00000032410

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 1.2e-103 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1661 1680 N/A INTRINSIC
low complexity region 1692 1707 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190665
SMART Domains Protein: ENSMUSP00000139510
Gene: ENSMUSG00000032410

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 4.9e-104 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
PDB:2Y35|A 654 939 2e-36 PDB
low complexity region 946 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-3' exonuclease family. The encoded protein may be involved in replication-dependent histone mRNA degradation, and interacts directly with the enhancer of mRNA-decapping protein 4. In addition to mRNA metabolism, a similar protein in yeast has been implicated in a variety of nuclear and cytoplasmic functions, including homologous recombination, meiosis, telomere maintenance, and microtubule assembly. Mutations in this gene are associated with osteosarcoma, suggesting that the encoded protein may also play a role in bone formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,514,602 W899R probably damaging Het
Abca5 A T 11: 110,272,497 W1631R possibly damaging Het
Actg2 T A 6: 83,527,368 D25V probably damaging Het
Akap10 G C 11: 61,915,505 D132E probably damaging Het
Angptl2 G T 2: 33,242,382 E334* probably null Het
Aprt T C 8: 122,574,935 R165G probably benign Het
B020004J07Rik T C 4: 101,837,141 I182V possibly damaging Het
Bmp1 A G 14: 70,492,084 F549S probably damaging Het
Capzb C T 4: 139,280,553 T215I probably benign Het
Car14 C T 3: 95,904,372 M1I probably null Het
Ccdc148 T A 2: 58,823,636 Q501L probably benign Het
Ccdc32 G A 2: 119,027,347 T12I probably damaging Het
Ccnf G A 17: 24,225,012 S594L probably damaging Het
Cdadc1 C T 14: 59,573,834 C409Y probably damaging Het
Cdh23 G T 10: 60,312,577 S2670R probably damaging Het
Cdh8 T A 8: 99,279,674 K94* probably null Het
Cdhr2 A T 13: 54,717,692 Y193F probably damaging Het
Cdon T A 9: 35,454,415 Y153* probably null Het
Chd1 G A 17: 15,733,041 G413R probably damaging Het
Cit A T 5: 115,987,001 T1582S probably benign Het
Clec4a3 T C 6: 122,964,340 L98P probably benign Het
Cpa4 T A 6: 30,583,645 D253E probably damaging Het
Cyhr1 A T 15: 76,658,547 Y138N probably damaging Het
Cyp2c40 T A 19: 39,807,168 N189I possibly damaging Het
Daam2 G T 17: 49,490,022 A245E probably benign Het
Dennd5b A G 6: 149,068,658 F121S probably damaging Het
Dgkd A G 1: 87,926,949 T658A probably benign Het
Dmwd T A 7: 19,080,340 L305Q probably damaging Het
Dnah5 A T 15: 28,313,855 Y1939F probably damaging Het
Dock5 T C 14: 67,821,327 T512A probably damaging Het
Dopey2 T A 16: 93,755,514 D398E probably benign Het
Eef1akmt4 A G 16: 20,618,529 H207R probably damaging Het
Egfr T C 11: 16,891,266 V719A probably damaging Het
Ep300 A T 15: 81,586,583 probably benign Het
Epha4 A G 1: 77,390,031 probably null Het
Erc2 T G 14: 27,876,204 probably null Het
Ergic1 A T 17: 26,638,827 Y209F possibly damaging Het
Fbxw28 A G 9: 109,326,633 I357T probably damaging Het
Flnb A T 14: 7,926,478 T1841S probably benign Het
Foxc1 G A 13: 31,808,028 S274N probably benign Het
Fto C T 8: 91,409,443 T115M probably damaging Het
Gm10228 C G 16: 89,041,299 C39S unknown Het
Gm7334 T C 17: 50,698,715 F10L possibly damaging Het
Hfm1 A G 5: 106,881,861 Y785H probably damaging Het
Hivep1 T A 13: 42,159,461 S1726T probably benign Het
Htt G T 5: 34,852,190 C1505F probably damaging Het
Hydin T C 8: 110,505,843 S1665P possibly damaging Het
Ifi209 T A 1: 173,642,879 N344K probably damaging Het
Ifnar2 T C 16: 91,399,293 M262T probably benign Het
Ighv7-3 T A 12: 114,153,207 S112C probably damaging Het
Igkv4-86 A G 6: 68,910,579 S59P probably benign Het
Iglv1 A G 16: 19,085,489 probably benign Het
Ipo7 T A 7: 110,052,799 D928E possibly damaging Het
Itgae G T 11: 73,123,269 probably null Het
Kbtbd12 T A 6: 88,618,197 Q217L probably benign Het
Kcnma1 T A 14: 23,300,006 Y1155F possibly damaging Het
Kif14 A G 1: 136,516,383 E1371G probably benign Het
Lilrb4a A T 10: 51,491,046 Y10F probably benign Het
Lrp2 A T 2: 69,503,388 V1503E probably damaging Het
Mfsd6 A T 1: 52,708,640 D355E probably benign Het
Mri1 T C 8: 84,251,028 H226R Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Muc4 T A 16: 32,753,311 L1063H probably benign Het
Mzf1 A T 7: 13,044,091 I541N probably damaging Het
Nasp T A 4: 116,612,033 E116D probably benign Het
Nlrp10 T A 7: 108,925,826 E149V probably damaging Het
Notch4 G A 17: 34,582,418 C1080Y probably damaging Het
Nova1 T G 12: 46,720,698 I147L unknown Het
Ogdh A G 11: 6,338,558 M223V probably benign Het
Olfr1391 G T 11: 49,327,671 A87S probably benign Het
Olfr444 T C 6: 42,955,789 I97T probably benign Het
Olfr732 A T 14: 50,281,488 I255N probably damaging Het
Olfr792 G T 10: 129,541,455 R306L probably benign Het
P3h3 T C 6: 124,854,432 Q330R probably benign Het
Pcdhb10 A G 18: 37,411,882 T4A not run Het
Pkd2l2 A T 18: 34,433,287 probably null Het
Plekhb1 C T 7: 100,645,663 V168I probably benign Het
Plxna4 C T 6: 32,223,980 R753H probably damaging Het
Prex1 G C 2: 166,713,709 P4A unknown Het
Ptgdr A G 14: 44,859,078 V59A probably damaging Het
Ralgapa1 T A 12: 55,757,955 I519F probably benign Het
Rbpms A G 8: 33,789,453 I170T probably benign Het
Sec31b T A 19: 44,523,835 probably null Het
Skint11 A T 4: 114,227,708 Y138F probably benign Het
Slain2 A G 5: 72,948,610 Y196C probably damaging Het
Slco1b2 T A 6: 141,676,224 C503* probably null Het
Slfn3 A T 11: 83,214,788 Y537F possibly damaging Het
Slu7 T C 11: 43,444,765 Y443H probably damaging Het
Sorl1 T A 9: 42,043,909 E683D probably damaging Het
Sos1 T A 17: 80,413,713 I893L probably benign Het
St8sia2 T A 7: 73,943,321 Y329F probably damaging Het
Stra6l C A 4: 45,869,570 S212* probably null Het
Syne3 C T 12: 104,997,495 probably benign Het
Tenm4 T A 7: 96,895,692 I2342N probably benign Het
Tescl T A 7: 24,333,263 E212D probably benign Het
Trip11 A G 12: 101,844,855 S1879P probably benign Het
Ube2c A T 2: 164,771,291 probably null Het
Umodl1 T A 17: 30,986,456 I675N probably benign Het
Vipr2 T C 12: 116,122,718 F121S probably damaging Het
Vmn1r206 A T 13: 22,620,669 S123T possibly damaging Het
Vmn1r58 A G 7: 5,410,913 V106A probably damaging Het
Vmn2r112 A G 17: 22,603,118 Y259C probably damaging Het
Vmn2r66 T C 7: 85,005,701 K467E probably benign Het
Vmn2r98 T C 17: 19,080,535 F600L probably benign Het
Vps13a T A 19: 16,746,000 N278I possibly damaging Het
Vwa5a A C 9: 38,741,162 D747A possibly damaging Het
Xdh G A 17: 73,934,834 P157S possibly damaging Het
Zfp362 T A 4: 128,787,031 H180L probably benign Het
Zfp560 A T 9: 20,347,323 W748R possibly damaging Het
Zfp808 A T 13: 62,172,664 Q569L probably benign Het
Zfp93 T A 7: 24,275,218 D209E possibly damaging Het
Other mutations in Xrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Xrn1 APN 9 96038949 missense probably benign 0.05
IGL00778:Xrn1 APN 9 95973447 splice site probably benign
IGL01936:Xrn1 APN 9 96048344 missense probably damaging 0.98
IGL01983:Xrn1 APN 9 95973368 critical splice donor site probably null
IGL02106:Xrn1 APN 9 95977805 missense probably benign 0.28
IGL02330:Xrn1 APN 9 95973348 nonsense probably null
IGL02338:Xrn1 APN 9 95977827 missense probably benign 0.42
IGL02830:Xrn1 APN 9 96018181 critical splice donor site probably null
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0467:Xrn1 UTSW 9 96024191 missense probably damaging 1.00
R0508:Xrn1 UTSW 9 96051736 missense probably benign 0.00
R0605:Xrn1 UTSW 9 96026877 nonsense probably null
R0670:Xrn1 UTSW 9 95991056 missense probably damaging 1.00
R0691:Xrn1 UTSW 9 95973539 missense probably damaging 0.96
R0781:Xrn1 UTSW 9 95991269 missense probably benign 0.00
R0947:Xrn1 UTSW 9 95998263 missense possibly damaging 0.60
R1034:Xrn1 UTSW 9 96039737 missense probably damaging 1.00
R1124:Xrn1 UTSW 9 96003865 missense probably benign 0.02
R1171:Xrn1 UTSW 9 95991011 missense possibly damaging 0.47
R1199:Xrn1 UTSW 9 95981761 splice site probably benign
R1609:Xrn1 UTSW 9 95974893 missense probably benign 0.03
R1921:Xrn1 UTSW 9 95999497 missense probably benign 0.04
R1953:Xrn1 UTSW 9 96024221 critical splice donor site probably null
R2000:Xrn1 UTSW 9 96045563 nonsense probably null
R2109:Xrn1 UTSW 9 95979220 missense probably benign 0.13
R2111:Xrn1 UTSW 9 96039832 missense probably benign 0.03
R2164:Xrn1 UTSW 9 96006820 missense possibly damaging 0.95
R2266:Xrn1 UTSW 9 96006712 missense possibly damaging 0.64
R3754:Xrn1 UTSW 9 95967788 missense probably damaging 1.00
R3783:Xrn1 UTSW 9 95969285 missense probably benign 0.10
R3921:Xrn1 UTSW 9 95969284 missense probably benign 0.01
R3929:Xrn1 UTSW 9 95988873 missense possibly damaging 0.89
R4011:Xrn1 UTSW 9 95985225 nonsense probably null
R4082:Xrn1 UTSW 9 95981920 missense probably benign 0.02
R4455:Xrn1 UTSW 9 95973645 intron probably benign
R4736:Xrn1 UTSW 9 96033636 missense probably damaging 1.00
R4756:Xrn1 UTSW 9 96039809 missense probably benign 0.00
R4780:Xrn1 UTSW 9 95974744 intron probably benign
R5152:Xrn1 UTSW 9 95964065 missense probably benign 0.40
R5261:Xrn1 UTSW 9 96045543 missense probably benign 0.00
R5741:Xrn1 UTSW 9 96045551 missense probably benign 0.24
R6108:Xrn1 UTSW 9 95974427 missense possibly damaging 0.91
R6127:Xrn1 UTSW 9 95969489 missense probably damaging 0.99
R6268:Xrn1 UTSW 9 95964014 missense probably damaging 1.00
R6418:Xrn1 UTSW 9 96033710 splice site probably null
R7002:Xrn1 UTSW 9 96047790 missense probably benign 0.00
R7067:Xrn1 UTSW 9 95969512 missense probably damaging 0.98
R7155:Xrn1 UTSW 9 95979145 missense possibly damaging 0.92
R7439:Xrn1 UTSW 9 96051629 missense probably benign
R7447:Xrn1 UTSW 9 96045494 missense probably benign
R7454:Xrn1 UTSW 9 96048358 missense probably benign 0.03
R7473:Xrn1 UTSW 9 95979141 missense probably benign 0.07
R7561:Xrn1 UTSW 9 95999458 missense probably benign 0.18
R7580:Xrn1 UTSW 9 96011679 missense not run
R7642:Xrn1 UTSW 9 96021853 missense possibly damaging 0.95
R8225:Xrn1 UTSW 9 96035667 missense probably benign
R8372:Xrn1 UTSW 9 96024113 missense probably benign 0.42
R8516:Xrn1 UTSW 9 96048391 nonsense probably null
R8710:Xrn1 UTSW 9 96002232 missense not run
Z1176:Xrn1 UTSW 9 95964190 missense probably damaging 1.00
Z1177:Xrn1 UTSW 9 95991005 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTGGATAAGCTCTACATTAAAGCAC -3'
(R):5'- TGGAAGCATAGATTTGACACTGC -3'

Sequencing Primer
(F):5'- CTACATTAAAGCACAAATTTAGGCTC -3'
(R):5'- AAGTTGTGTGCCATCATGCTCAAC -3'
Posted On2019-11-26