Mutagenetix > Incidental Mutation

Incidental Mutation 'R7763:Itgae'

598051

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

CD103, alpha-E1

MMRRC Submission

045819-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73090583-73147446 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 73123269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000006101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably null
Transcript: ENSMUST00000006101

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102537

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,514,602	W899R	probably damaging	Het
Abca5	A	T	11: 110,272,497	W1631R	possibly damaging	Het
Actg2	T	A	6: 83,527,368	D25V	probably damaging	Het
Akap10	G	C	11: 61,915,505	D132E	probably damaging	Het
Angptl2	G	T	2: 33,242,382	E334*	probably null	Het
Aprt	T	C	8: 122,574,935	R165G	probably benign	Het
B020004J07Rik	T	C	4: 101,837,141	I182V	possibly damaging	Het
Bmp1	A	G	14: 70,492,084	F549S	probably damaging	Het
Capzb	C	T	4: 139,280,553	T215I	probably benign	Het
Car14	C	T	3: 95,904,372	M1I	probably null	Het
Ccdc148	T	A	2: 58,823,636	Q501L	probably benign	Het
Ccdc32	G	A	2: 119,027,347	T12I	probably damaging	Het
Ccnf	G	A	17: 24,225,012	S594L	probably damaging	Het
Cdadc1	C	T	14: 59,573,834	C409Y	probably damaging	Het
Cdh23	G	T	10: 60,312,577	S2670R	probably damaging	Het
Cdh8	T	A	8: 99,279,674	K94*	probably null	Het
Cdhr2	A	T	13: 54,717,692	Y193F	probably damaging	Het
Cdon	T	A	9: 35,454,415	Y153*	probably null	Het
Chd1	G	A	17: 15,733,041	G413R	probably damaging	Het
Cit	A	T	5: 115,987,001	T1582S	probably benign	Het
Clec4a3	T	C	6: 122,964,340	L98P	probably benign	Het
Cpa4	T	A	6: 30,583,645	D253E	probably damaging	Het
Cyhr1	A	T	15: 76,658,547	Y138N	probably damaging	Het
Cyp2c40	T	A	19: 39,807,168	N189I	possibly damaging	Het
Daam2	G	T	17: 49,490,022	A245E	probably benign	Het
Dennd5b	A	G	6: 149,068,658	F121S	probably damaging	Het
Dgkd	A	G	1: 87,926,949	T658A	probably benign	Het
Dmwd	T	A	7: 19,080,340	L305Q	probably damaging	Het
Dnah5	A	T	15: 28,313,855	Y1939F	probably damaging	Het
Dock5	T	C	14: 67,821,327	T512A	probably damaging	Het
Dopey2	T	A	16: 93,755,514	D398E	probably benign	Het
Eef1akmt4	A	G	16: 20,618,529	H207R	probably damaging	Het
Egfr	T	C	11: 16,891,266	V719A	probably damaging	Het
Ep300	A	T	15: 81,586,583		probably benign	Het
Epha4	A	G	1: 77,390,031		probably null	Het
Erc2	T	G	14: 27,876,204		probably null	Het
Ergic1	A	T	17: 26,638,827	Y209F	possibly damaging	Het
Fbxw28	A	G	9: 109,326,633	I357T	probably damaging	Het
Flnb	A	T	14: 7,926,478	T1841S	probably benign	Het
Foxc1	G	A	13: 31,808,028	S274N	probably benign	Het
Fto	C	T	8: 91,409,443	T115M	probably damaging	Het
Gm10228	C	G	16: 89,041,299	C39S	unknown	Het
Gm7334	T	C	17: 50,698,715	F10L	possibly damaging	Het
Hfm1	A	G	5: 106,881,861	Y785H	probably damaging	Het
Hivep1	T	A	13: 42,159,461	S1726T	probably benign	Het
Htt	G	T	5: 34,852,190	C1505F	probably damaging	Het
Hydin	T	C	8: 110,505,843	S1665P	possibly damaging	Het
Ifi209	T	A	1: 173,642,879	N344K	probably damaging	Het
Ifnar2	T	C	16: 91,399,293	M262T	probably benign	Het
Ighv7-3	T	A	12: 114,153,207	S112C	probably damaging	Het
Igkv4-86	A	G	6: 68,910,579	S59P	probably benign	Het
Iglv1	A	G	16: 19,085,489		probably benign	Het
Ipo7	T	A	7: 110,052,799	D928E	possibly damaging	Het
Kbtbd12	T	A	6: 88,618,197	Q217L	probably benign	Het
Kcnma1	T	A	14: 23,300,006	Y1155F	possibly damaging	Het
Kif14	A	G	1: 136,516,383	E1371G	probably benign	Het
Lilrb4a	A	T	10: 51,491,046	Y10F	probably benign	Het
Lrp2	A	T	2: 69,503,388	V1503E	probably damaging	Het
Mfsd6	A	T	1: 52,708,640	D355E	probably benign	Het
Mri1	T	C	8: 84,251,028	H226R		Het
Mroh4	C	T	15: 74,624,705	E278K	probably damaging	Het
Muc4	T	A	16: 32,753,311	L1063H	probably benign	Het
Mzf1	A	T	7: 13,044,091	I541N	probably damaging	Het
Nasp	T	A	4: 116,612,033	E116D	probably benign	Het
Nlrp10	T	A	7: 108,925,826	E149V	probably damaging	Het
Notch4	G	A	17: 34,582,418	C1080Y	probably damaging	Het
Nova1	T	G	12: 46,720,698	I147L	unknown	Het
Ogdh	A	G	11: 6,338,558	M223V	probably benign	Het
Olfr1391	G	T	11: 49,327,671	A87S	probably benign	Het
Olfr444	T	C	6: 42,955,789	I97T	probably benign	Het
Olfr732	A	T	14: 50,281,488	I255N	probably damaging	Het
Olfr792	G	T	10: 129,541,455	R306L	probably benign	Het
P3h3	T	C	6: 124,854,432	Q330R	probably benign	Het
Pcdhb10	A	G	18: 37,411,882	T4A	not run	Het
Pkd2l2	A	T	18: 34,433,287		probably null	Het
Plekhb1	C	T	7: 100,645,663	V168I	probably benign	Het
Plxna4	C	T	6: 32,223,980	R753H	probably damaging	Het
Prex1	G	C	2: 166,713,709	P4A	unknown	Het
Ptgdr	A	G	14: 44,859,078	V59A	probably damaging	Het
Ralgapa1	T	A	12: 55,757,955	I519F	probably benign	Het
Rbpms	A	G	8: 33,789,453	I170T	probably benign	Het
Sec31b	T	A	19: 44,523,835		probably null	Het
Skint11	A	T	4: 114,227,708	Y138F	probably benign	Het
Slain2	A	G	5: 72,948,610	Y196C	probably damaging	Het
Slco1b2	T	A	6: 141,676,224	C503*	probably null	Het
Slfn3	A	T	11: 83,214,788	Y537F	possibly damaging	Het
Slu7	T	C	11: 43,444,765	Y443H	probably damaging	Het
Sorl1	T	A	9: 42,043,909	E683D	probably damaging	Het
Sos1	T	A	17: 80,413,713	I893L	probably benign	Het
St8sia2	T	A	7: 73,943,321	Y329F	probably damaging	Het
Stra6l	C	A	4: 45,869,570	S212*	probably null	Het
Syne3	C	T	12: 104,997,495		probably benign	Het
Tenm4	T	A	7: 96,895,692	I2342N	probably benign	Het
Tescl	T	A	7: 24,333,263	E212D	probably benign	Het
Trip11	A	G	12: 101,844,855	S1879P	probably benign	Het
Ube2c	A	T	2: 164,771,291		probably null	Het
Umodl1	T	A	17: 30,986,456	I675N	probably benign	Het
Vipr2	T	C	12: 116,122,718	F121S	probably damaging	Het
Vmn1r206	A	T	13: 22,620,669	S123T	possibly damaging	Het
Vmn1r58	A	G	7: 5,410,913	V106A	probably damaging	Het
Vmn2r112	A	G	17: 22,603,118	Y259C	probably damaging	Het
Vmn2r66	T	C	7: 85,005,701	K467E	probably benign	Het
Vmn2r98	T	C	17: 19,080,535	F600L	probably benign	Het
Vps13a	T	A	19: 16,746,000	N278I	possibly damaging	Het
Vwa5a	A	C	9: 38,741,162	D747A	possibly damaging	Het
Xdh	G	A	17: 73,934,834	P157S	possibly damaging	Het
Xrn1	G	A	9: 95,998,348		probably null	Het
Zfp362	T	A	4: 128,787,031	H180L	probably benign	Het
Zfp560	A	T	9: 20,347,323	W748R	possibly damaging	Het
Zfp808	A	T	13: 62,172,664	Q569L	probably benign	Het
Zfp93	T	A	7: 24,275,218	D209E	possibly damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73145635	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73113694	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73123148	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73119437	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73119378	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73111759	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73116137	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73118184	missense	probably benign	0.29
IGL02149:Itgae	APN	11	73103894	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73134018	missense	probably benign	0.06
IGL02231:Itgae	APN	11	73090622	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73118535	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73118121	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73130951	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73118505	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73118203	splice site	probably benign
IGL02859:Itgae	APN	11	73114867	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73125310	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73113601	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73115574	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73133854	splice site	probably null
IGL03352:Itgae	APN	11	73131730	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73130999	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73118147	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73123183	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73114907	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73138509	nonsense	probably null
R1231:Itgae	UTSW	11	73119379	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73125362	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73115592	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73145605	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73117162	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73118643	splice site	probably benign
R1915:Itgae	UTSW	11	73118643	splice site	probably benign
R2061:Itgae	UTSW	11	73118622	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73145569	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73121937	nonsense	probably null
R2680:Itgae	UTSW	11	73114926	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73140687	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73113616	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73111339	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73112134	missense	probably benign
R4212:Itgae	UTSW	11	73119352	missense	probably benign
R4213:Itgae	UTSW	11	73119352	missense	probably benign
R4691:Itgae	UTSW	11	73119519	nonsense	probably null
R4736:Itgae	UTSW	11	73114880	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73130995	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73110556	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73145638	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73111849	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73133908	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73129248	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73145551	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73140757	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73145601	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73131693	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73111402	splice site	probably null
R6502:Itgae	UTSW	11	73145592	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73118496	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73119516	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73111369	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73111358	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73140678	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73121960	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73113631	missense	probably damaging	1.00
R7829:Itgae	UTSW	11	73138792	missense	probably benign
R7860:Itgae	UTSW	11	73120273	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73134087	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73120384	missense	probably benign
R8911:Itgae	UTSW	11	73113621	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73125263	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73121926	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73116080	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73111803	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73125356	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73120345	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73111376	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1186:Itgae	UTSW	11	73115640	missense	probably benign
Z1186:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1187:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73115640	missense	probably benign
Z1187:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1188:Itgae	UTSW	11	73115640	missense	probably benign
Z1188:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	73115640	missense	probably benign
Z1189:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1190:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73115640	missense	probably benign
Z1190:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	73115640	missense	probably benign
Z1191:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1192:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73115640	missense	probably benign
Z1192:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73134127	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- TTCCCAGGCTCATCAGAAGG -3'
(R):5'- CACTAACTGCAGTGCCTCAC -3'

Sequencing Primer
(F):5'- CATCAGAAGGTCTGGTCTTCAAC -3'
(R):5'- GAGCATGCAGAGCTCACTC -3'

Posted On

2019-11-26