Mutagenetix > Incidental Mutation

Incidental Mutation 'R7763:Trip11'

598056

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230

MMRRC Submission

Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101834043-101913267 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101844855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1879 (S1879P)

Ref Sequence

ENSEMBL: ENSMUSP00000021605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183]

AlphaFold

E9Q512

Predicted Effect

probably benign
Transcript: ENSMUST00000021605
AA Change: S1879P

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: S1879P

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177183
AA Change: S1594P

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: S1594P

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,514,602	W899R	probably damaging	Het
Abca5	A	T	11: 110,272,497	W1631R	possibly damaging	Het
Actg2	T	A	6: 83,527,368	D25V	probably damaging	Het
Akap10	G	C	11: 61,915,505	D132E	probably damaging	Het
Angptl2	G	T	2: 33,242,382	E334*	probably null	Het
Aprt	T	C	8: 122,574,935	R165G	probably benign	Het
B020004J07Rik	T	C	4: 101,837,141	I182V	possibly damaging	Het
Bmp1	A	G	14: 70,492,084	F549S	probably damaging	Het
Capzb	C	T	4: 139,280,553	T215I	probably benign	Het
Car14	C	T	3: 95,904,372	M1I	probably null	Het
Ccdc148	T	A	2: 58,823,636	Q501L	probably benign	Het
Ccdc32	G	A	2: 119,027,347	T12I	probably damaging	Het
Ccnf	G	A	17: 24,225,012	S594L	probably damaging	Het
Cdadc1	C	T	14: 59,573,834	C409Y	probably damaging	Het
Cdh23	G	T	10: 60,312,577	S2670R	probably damaging	Het
Cdh8	T	A	8: 99,279,674	K94*	probably null	Het
Cdhr2	A	T	13: 54,717,692	Y193F	probably damaging	Het
Cdon	T	A	9: 35,454,415	Y153*	probably null	Het
Chd1	G	A	17: 15,733,041	G413R	probably damaging	Het
Cit	A	T	5: 115,987,001	T1582S	probably benign	Het
Clec4a3	T	C	6: 122,964,340	L98P	probably benign	Het
Cpa4	T	A	6: 30,583,645	D253E	probably damaging	Het
Cyhr1	A	T	15: 76,658,547	Y138N	probably damaging	Het
Cyp2c40	T	A	19: 39,807,168	N189I	possibly damaging	Het
Daam2	G	T	17: 49,490,022	A245E	probably benign	Het
Dennd5b	A	G	6: 149,068,658	F121S	probably damaging	Het
Dgkd	A	G	1: 87,926,949	T658A	probably benign	Het
Dmwd	T	A	7: 19,080,340	L305Q	probably damaging	Het
Dnah5	A	T	15: 28,313,855	Y1939F	probably damaging	Het
Dock5	T	C	14: 67,821,327	T512A	probably damaging	Het
Dopey2	T	A	16: 93,755,514	D398E	probably benign	Het
Eef1akmt4	A	G	16: 20,618,529	H207R	probably damaging	Het
Egfr	T	C	11: 16,891,266	V719A	probably damaging	Het
Ep300	A	T	15: 81,586,583		probably benign	Het
Epha4	A	G	1: 77,390,031		probably null	Het
Erc2	T	G	14: 27,876,204		probably null	Het
Ergic1	A	T	17: 26,638,827	Y209F	possibly damaging	Het
Fbxw28	A	G	9: 109,326,633	I357T	probably damaging	Het
Flnb	A	T	14: 7,926,478	T1841S	probably benign	Het
Foxc1	G	A	13: 31,808,028	S274N	probably benign	Het
Fto	C	T	8: 91,409,443	T115M	probably damaging	Het
Gm10228	C	G	16: 89,041,299	C39S	unknown	Het
Gm7334	T	C	17: 50,698,715	F10L	possibly damaging	Het
Hfm1	A	G	5: 106,881,861	Y785H	probably damaging	Het
Hivep1	T	A	13: 42,159,461	S1726T	probably benign	Het
Htt	G	T	5: 34,852,190	C1505F	probably damaging	Het
Hydin	T	C	8: 110,505,843	S1665P	possibly damaging	Het
Ifi209	T	A	1: 173,642,879	N344K	probably damaging	Het
Ifnar2	T	C	16: 91,399,293	M262T	probably benign	Het
Ighv7-3	T	A	12: 114,153,207	S112C	probably damaging	Het
Igkv4-86	A	G	6: 68,910,579	S59P	probably benign	Het
Iglv1	A	G	16: 19,085,489		probably benign	Het
Ipo7	T	A	7: 110,052,799	D928E	possibly damaging	Het
Itgae	G	T	11: 73,123,269		probably null	Het
Kbtbd12	T	A	6: 88,618,197	Q217L	probably benign	Het
Kcnma1	T	A	14: 23,300,006	Y1155F	possibly damaging	Het
Kif14	A	G	1: 136,516,383	E1371G	probably benign	Het
Lilrb4a	A	T	10: 51,491,046	Y10F	probably benign	Het
Lrp2	A	T	2: 69,503,388	V1503E	probably damaging	Het
Mfsd6	A	T	1: 52,708,640	D355E	probably benign	Het
Mri1	T	C	8: 84,251,028	H226R		Het
Mroh4	C	T	15: 74,624,705	E278K	probably damaging	Het
Muc4	T	A	16: 32,753,311	L1063H	probably benign	Het
Mzf1	A	T	7: 13,044,091	I541N	probably damaging	Het
Nasp	T	A	4: 116,612,033	E116D	probably benign	Het
Nlrp10	T	A	7: 108,925,826	E149V	probably damaging	Het
Notch4	G	A	17: 34,582,418	C1080Y	probably damaging	Het
Nova1	T	G	12: 46,720,698	I147L	unknown	Het
Ogdh	A	G	11: 6,338,558	M223V	probably benign	Het
Olfr1391	G	T	11: 49,327,671	A87S	probably benign	Het
Olfr444	T	C	6: 42,955,789	I97T	probably benign	Het
Olfr732	A	T	14: 50,281,488	I255N	probably damaging	Het
Olfr792	G	T	10: 129,541,455	R306L	probably benign	Het
P3h3	T	C	6: 124,854,432	Q330R	probably benign	Het
Pcdhb10	A	G	18: 37,411,882	T4A	not run	Het
Pkd2l2	A	T	18: 34,433,287		probably null	Het
Plekhb1	C	T	7: 100,645,663	V168I	probably benign	Het
Plxna4	C	T	6: 32,223,980	R753H	probably damaging	Het
Prex1	G	C	2: 166,713,709	P4A	unknown	Het
Ptgdr	A	G	14: 44,859,078	V59A	probably damaging	Het
Ralgapa1	T	A	12: 55,757,955	I519F	probably benign	Het
Rbpms	A	G	8: 33,789,453	I170T	probably benign	Het
Sec31b	T	A	19: 44,523,835		probably null	Het
Skint11	A	T	4: 114,227,708	Y138F	probably benign	Het
Slain2	A	G	5: 72,948,610	Y196C	probably damaging	Het
Slco1b2	T	A	6: 141,676,224	C503*	probably null	Het
Slfn3	A	T	11: 83,214,788	Y537F	possibly damaging	Het
Slu7	T	C	11: 43,444,765	Y443H	probably damaging	Het
Sorl1	T	A	9: 42,043,909	E683D	probably damaging	Het
Sos1	T	A	17: 80,413,713	I893L	probably benign	Het
St8sia2	T	A	7: 73,943,321	Y329F	probably damaging	Het
Stra6l	C	A	4: 45,869,570	S212*	probably null	Het
Syne3	C	T	12: 104,997,495		probably benign	Het
Tenm4	T	A	7: 96,895,692	I2342N	probably benign	Het
Tescl	T	A	7: 24,333,263	E212D	probably benign	Het
Ube2c	A	T	2: 164,771,291		probably null	Het
Umodl1	T	A	17: 30,986,456	I675N	probably benign	Het
Vipr2	T	C	12: 116,122,718	F121S	probably damaging	Het
Vmn1r206	A	T	13: 22,620,669	S123T	possibly damaging	Het
Vmn1r58	A	G	7: 5,410,913	V106A	probably damaging	Het
Vmn2r112	A	G	17: 22,603,118	Y259C	probably damaging	Het
Vmn2r66	T	C	7: 85,005,701	K467E	probably benign	Het
Vmn2r98	T	C	17: 19,080,535	F600L	probably benign	Het
Vps13a	T	A	19: 16,746,000	N278I	possibly damaging	Het
Vwa5a	A	C	9: 38,741,162	D747A	possibly damaging	Het
Xdh	G	A	17: 73,934,834	P157S	possibly damaging	Het
Xrn1	G	A	9: 95,998,348		probably null	Het
Zfp362	T	A	4: 128,787,031	H180L	probably benign	Het
Zfp560	A	T	9: 20,347,323	W748R	possibly damaging	Het
Zfp808	A	T	13: 62,172,664	Q569L	probably benign	Het
Zfp93	T	A	7: 24,275,218	D209E	possibly damaging	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101886147	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101885311	nonsense	probably null
IGL00972:Trip11	APN	12	101894337	missense	probably null	1.00
IGL01476:Trip11	APN	12	101898911	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101883345	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101878862	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101884631	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101871831	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101884488	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101885676	missense	probably benign
IGL01924:Trip11	APN	12	101886884	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101884313	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101895683	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101893521	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101883390	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101884001	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101886025	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101886838	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101883936	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101898925	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101883418	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101885019	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101894321	splice site	probably null
R0027:Trip11	UTSW	12	101885169	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101884757	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101885672	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101884518	nonsense	probably null
R0573:Trip11	UTSW	12	101886860	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101885976	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101886160	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101912767	missense	unknown
R1647:Trip11	UTSW	12	101884392	nonsense	probably null
R1648:Trip11	UTSW	12	101884392	nonsense	probably null
R1856:Trip11	UTSW	12	101883333	nonsense	probably null
R2013:Trip11	UTSW	12	101837722	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101885360	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101898977	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101878827	makesense	probably null
R2513:Trip11	UTSW	12	101837727	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101893694	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101894322	nonsense	probably null
R4124:Trip11	UTSW	12	101895698	nonsense	probably null
R4126:Trip11	UTSW	12	101895698	nonsense	probably null
R4128:Trip11	UTSW	12	101895698	nonsense	probably null
R4175:Trip11	UTSW	12	101895698	nonsense	probably null
R4176:Trip11	UTSW	12	101895698	nonsense	probably null
R4181:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101885868	nonsense	probably null
R4302:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101886939	missense	probably benign
R4342:Trip11	UTSW	12	101884316	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101886240	nonsense	probably null
R4586:Trip11	UTSW	12	101883341	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101837616	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101885290	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101885446	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101886806	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101884910	nonsense	probably null
R5017:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101884920	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101885601	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101885127	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101885665	nonsense	probably null
R5755:Trip11	UTSW	12	101885665	nonsense	probably null
R5890:Trip11	UTSW	12	101885972	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101883479	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101889742	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101898895	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101890600	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101885578	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101885531	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101837627	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101893683	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101885867	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101884070	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101884352	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101885198	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101884019	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101885380	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101885435	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101886974	missense	probably benign	0.01
R7779:Trip11	UTSW	12	101883537	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101837665	missense	probably damaging	1.00
R8076:Trip11	UTSW	12	101883482	missense	probably damaging	1.00
R8288:Trip11	UTSW	12	101894384	missense	possibly damaging	0.73
R8294:Trip11	UTSW	12	101844901	missense	possibly damaging	0.93
R8318:Trip11	UTSW	12	101912804	missense	unknown
R8690:Trip11	UTSW	12	101873397	missense	possibly damaging	0.76
R8879:Trip11	UTSW	12	101862598	missense	probably benign	0.00
R8964:Trip11	UTSW	12	101845056	critical splice donor site	probably null
R9005:Trip11	UTSW	12	101878872	missense	probably benign	0.02
R9013:Trip11	UTSW	12	101885118	missense	probably damaging	0.99
R9020:Trip11	UTSW	12	101884511	missense	possibly damaging	0.91
R9041:Trip11	UTSW	12	101878868	missense	probably benign	0.06
R9234:Trip11	UTSW	12	101845731	critical splice donor site	probably null
R9447:Trip11	UTSW	12	101883889	missense	probably damaging	1.00
R9631:Trip11	UTSW	12	101893548	missense	probably benign
R9641:Trip11	UTSW	12	101893698	nonsense	probably null
R9691:Trip11	UTSW	12	101883864	missense	probably benign	0.00
R9751:Trip11	UTSW	12	101884506	missense	possibly damaging	0.54
X0020:Trip11	UTSW	12	101885913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACGGCCAATGAAAGATTTCTCATG -3'
(R):5'- TTATTCCTGCTGAACGTGAATG -3'

Sequencing Primer
(F):5'- GAAGACTCTGGGAATTAGTCCTAC -3'
(R):5'- TCCTGCTGAACGTGAATGATAAAGTG -3'

Posted On

2019-11-26