Incidental Mutation 'R7763:Vipr2'
ID 598059
Institutional Source Beutler Lab
Gene Symbol Vipr2
Ensembl Gene ENSMUSG00000011171
Gene Name vasoactive intestinal peptide receptor 2
Synonyms VPAC2R, VPAC2, VIP receptor subtype 2, Vip2
MMRRC Submission 045819-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116041346-116109881 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116086338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 121 (F121S)
Ref Sequence ENSEMBL: ENSMUSP00000011315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011315]
AlphaFold P41588
Predicted Effect probably damaging
Transcript: ENSMUST00000011315
AA Change: F121S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011315
Gene: ENSMUSG00000011171
AA Change: F121S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 47 117 8.35e-25 SMART
Pfam:7tm_2 122 370 1.5e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced delayed-type hypersensitivity (type IV) and reduced immediate-type hypersensitivity (type I). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,113,825 (GRCm39) W899R probably damaging Het
Abca5 A T 11: 110,163,323 (GRCm39) W1631R possibly damaging Het
Actg2 T A 6: 83,504,350 (GRCm39) D25V probably damaging Het
Akap10 G C 11: 61,806,331 (GRCm39) D132E probably damaging Het
Angptl2 G T 2: 33,132,394 (GRCm39) E334* probably null Het
Aprt T C 8: 123,301,674 (GRCm39) R165G probably benign Het
Bmp1 A G 14: 70,729,524 (GRCm39) F549S probably damaging Het
Capzb C T 4: 139,007,864 (GRCm39) T215I probably benign Het
Car14 C T 3: 95,811,684 (GRCm39) M1I probably null Het
Ccdc148 T A 2: 58,713,648 (GRCm39) Q501L probably benign Het
Ccdc32 G A 2: 118,857,828 (GRCm39) T12I probably damaging Het
Ccnf G A 17: 24,443,986 (GRCm39) S594L probably damaging Het
Cdadc1 C T 14: 59,811,283 (GRCm39) C409Y probably damaging Het
Cdh23 G T 10: 60,148,356 (GRCm39) S2670R probably damaging Het
Cdh8 T A 8: 100,006,306 (GRCm39) K94* probably null Het
Cdhr2 A T 13: 54,865,505 (GRCm39) Y193F probably damaging Het
Cdon T A 9: 35,365,711 (GRCm39) Y153* probably null Het
Chd1 G A 17: 15,953,303 (GRCm39) G413R probably damaging Het
Cit A T 5: 116,125,060 (GRCm39) T1582S probably benign Het
Clec4a3 T C 6: 122,941,299 (GRCm39) L98P probably benign Het
Cpa4 T A 6: 30,583,644 (GRCm39) D253E probably damaging Het
Cyp2c40 T A 19: 39,795,612 (GRCm39) N189I possibly damaging Het
Daam2 G T 17: 49,797,050 (GRCm39) A245E probably benign Het
Dennd5b A G 6: 148,970,156 (GRCm39) F121S probably damaging Het
Dgkd A G 1: 87,854,671 (GRCm39) T658A probably benign Het
Dmwd T A 7: 18,814,265 (GRCm39) L305Q probably damaging Het
Dnah5 A T 15: 28,314,001 (GRCm39) Y1939F probably damaging Het
Dock5 T C 14: 68,058,776 (GRCm39) T512A probably damaging Het
Dop1b T A 16: 93,552,402 (GRCm39) D398E probably benign Het
Eef1akmt4 A G 16: 20,437,279 (GRCm39) H207R probably damaging Het
Egfr T C 11: 16,841,266 (GRCm39) V719A probably damaging Het
Ep300 A T 15: 81,470,784 (GRCm39) probably benign Het
Epha4 A G 1: 77,366,668 (GRCm39) probably null Het
Erc2 T G 14: 27,598,161 (GRCm39) probably null Het
Ergic1 A T 17: 26,857,801 (GRCm39) Y209F possibly damaging Het
Fbxw28 A G 9: 109,155,701 (GRCm39) I357T probably damaging Het
Flnb A T 14: 7,926,478 (GRCm38) T1841S probably benign Het
Foxc1 G A 13: 31,992,011 (GRCm39) S274N probably benign Het
Fto C T 8: 92,136,071 (GRCm39) T115M probably damaging Het
Gm10228 C G 16: 88,838,187 (GRCm39) C39S unknown Het
Gm7334 T C 17: 51,005,743 (GRCm39) F10L possibly damaging Het
Hfm1 A G 5: 107,029,727 (GRCm39) Y785H probably damaging Het
Hivep1 T A 13: 42,312,937 (GRCm39) S1726T probably benign Het
Htt G T 5: 35,009,534 (GRCm39) C1505F probably damaging Het
Hydin T C 8: 111,232,475 (GRCm39) S1665P possibly damaging Het
Ifi209 T A 1: 173,470,445 (GRCm39) N344K probably damaging Het
Ifnar2 T C 16: 91,196,181 (GRCm39) M262T probably benign Het
Ighv7-3 T A 12: 114,116,827 (GRCm39) S112C probably damaging Het
Igkv4-86 A G 6: 68,887,563 (GRCm39) S59P probably benign Het
Iglv1 A G 16: 18,904,239 (GRCm39) probably benign Het
Ipo7 T A 7: 109,652,006 (GRCm39) D928E possibly damaging Het
Itgae G T 11: 73,014,095 (GRCm39) probably null Het
Kbtbd12 T A 6: 88,595,179 (GRCm39) Q217L probably benign Het
Kcnma1 T A 14: 23,350,074 (GRCm39) Y1155F possibly damaging Het
Kif14 A G 1: 136,444,121 (GRCm39) E1371G probably benign Het
Lilrb4a A T 10: 51,367,142 (GRCm39) Y10F probably benign Het
Lrp2 A T 2: 69,333,732 (GRCm39) V1503E probably damaging Het
Mfsd6 A T 1: 52,747,799 (GRCm39) D355E probably benign Het
Mri1 T C 8: 84,977,657 (GRCm39) H226R Het
Mroh4 C T 15: 74,496,554 (GRCm39) E278K probably damaging Het
Muc4 T A 16: 32,574,739 (GRCm39) L1063H probably benign Het
Mzf1 A T 7: 12,778,018 (GRCm39) I541N probably damaging Het
Nasp T A 4: 116,469,230 (GRCm39) E116D probably benign Het
Nlrp10 T A 7: 108,525,033 (GRCm39) E149V probably damaging Het
Notch4 G A 17: 34,801,392 (GRCm39) C1080Y probably damaging Het
Nova1 T G 12: 46,767,481 (GRCm39) I147L unknown Het
Ogdh A G 11: 6,288,558 (GRCm39) M223V probably benign Het
Or2a56 T C 6: 42,932,723 (GRCm39) I97T probably benign Het
Or2y1e G T 11: 49,218,498 (GRCm39) A87S probably benign Het
Or4n4 A T 14: 50,518,945 (GRCm39) I255N probably damaging Het
Or6c66b G T 10: 129,377,324 (GRCm39) R306L probably benign Het
P3h3 T C 6: 124,831,395 (GRCm39) Q330R probably benign Het
Pcdhb10 A G 18: 37,544,935 (GRCm39) T4A not run Het
Pkd2l2 A T 18: 34,566,340 (GRCm39) probably null Het
Plekhb1 C T 7: 100,294,870 (GRCm39) V168I probably benign Het
Plxna4 C T 6: 32,200,915 (GRCm39) R753H probably damaging Het
Pramel17 T C 4: 101,694,338 (GRCm39) I182V possibly damaging Het
Prex1 G C 2: 166,555,629 (GRCm39) P4A unknown Het
Ptgdr A G 14: 45,096,535 (GRCm39) V59A probably damaging Het
Ralgapa1 T A 12: 55,804,740 (GRCm39) I519F probably benign Het
Rbpms A G 8: 34,279,481 (GRCm39) I170T probably benign Het
Sec31b T A 19: 44,512,274 (GRCm39) probably null Het
Skint11 A T 4: 114,084,905 (GRCm39) Y138F probably benign Het
Slain2 A G 5: 73,105,953 (GRCm39) Y196C probably damaging Het
Slco1b2 T A 6: 141,621,950 (GRCm39) C503* probably null Het
Slfn3 A T 11: 83,105,614 (GRCm39) Y537F possibly damaging Het
Slu7 T C 11: 43,335,592 (GRCm39) Y443H probably damaging Het
Sorl1 T A 9: 41,955,205 (GRCm39) E683D probably damaging Het
Sos1 T A 17: 80,721,142 (GRCm39) I893L probably benign Het
St8sia2 T A 7: 73,593,069 (GRCm39) Y329F probably damaging Het
Stra6l C A 4: 45,869,570 (GRCm39) S212* probably null Het
Syne3 C T 12: 104,963,754 (GRCm39) probably benign Het
Tenm4 T A 7: 96,544,899 (GRCm39) I2342N probably benign Het
Tescl T A 7: 24,032,688 (GRCm39) E212D probably benign Het
Trip11 A G 12: 101,811,114 (GRCm39) S1879P probably benign Het
Ube2c A T 2: 164,613,211 (GRCm39) probably null Het
Umodl1 T A 17: 31,205,430 (GRCm39) I675N probably benign Het
Vmn1r206 A T 13: 22,804,839 (GRCm39) S123T possibly damaging Het
Vmn1r58 A G 7: 5,413,912 (GRCm39) V106A probably damaging Het
Vmn2r112 A G 17: 22,822,099 (GRCm39) Y259C probably damaging Het
Vmn2r66 T C 7: 84,654,909 (GRCm39) K467E probably benign Het
Vmn2r98 T C 17: 19,300,797 (GRCm39) F600L probably benign Het
Vps13a T A 19: 16,723,364 (GRCm39) N278I possibly damaging Het
Vwa5a A C 9: 38,652,458 (GRCm39) D747A possibly damaging Het
Xdh G A 17: 74,241,829 (GRCm39) P157S possibly damaging Het
Xrn1 G A 9: 95,880,401 (GRCm39) probably null Het
Zfp362 T A 4: 128,680,824 (GRCm39) H180L probably benign Het
Zfp560 A T 9: 20,258,619 (GRCm39) W748R possibly damaging Het
Zfp808 A T 13: 62,320,478 (GRCm39) Q569L probably benign Het
Zfp93 T A 7: 23,974,643 (GRCm39) D209E possibly damaging Het
Zftraf1 A T 15: 76,542,747 (GRCm39) Y138N probably damaging Het
Other mutations in Vipr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Vipr2 APN 12 116,102,368 (GRCm39) splice site probably null
IGL02233:Vipr2 APN 12 116,058,356 (GRCm39) missense probably damaging 0.99
IGL02691:Vipr2 APN 12 116,099,849 (GRCm39) missense probably benign 0.11
PIT4377001:Vipr2 UTSW 12 116,058,418 (GRCm39) missense probably benign 0.01
R0135:Vipr2 UTSW 12 116,106,447 (GRCm39) missense probably benign 0.00
R0207:Vipr2 UTSW 12 116,106,502 (GRCm39) missense probably damaging 1.00
R1389:Vipr2 UTSW 12 116,100,950 (GRCm39) missense probably benign 0.01
R1560:Vipr2 UTSW 12 116,058,401 (GRCm39) missense probably benign 0.18
R1575:Vipr2 UTSW 12 116,107,892 (GRCm39) missense probably benign
R1696:Vipr2 UTSW 12 116,102,777 (GRCm39) missense probably benign 0.13
R1970:Vipr2 UTSW 12 116,099,826 (GRCm39) missense probably benign 0.01
R2010:Vipr2 UTSW 12 116,086,430 (GRCm39) critical splice donor site probably null
R3873:Vipr2 UTSW 12 116,099,724 (GRCm39) unclassified probably benign
R4713:Vipr2 UTSW 12 116,043,751 (GRCm39) missense probably benign 0.00
R4953:Vipr2 UTSW 12 116,107,876 (GRCm39) missense probably benign 0.07
R6041:Vipr2 UTSW 12 116,106,604 (GRCm39) missense probably damaging 1.00
R6337:Vipr2 UTSW 12 116,086,363 (GRCm39) nonsense probably null
R6902:Vipr2 UTSW 12 116,102,819 (GRCm39) missense possibly damaging 0.46
R6946:Vipr2 UTSW 12 116,102,819 (GRCm39) missense possibly damaging 0.46
R9339:Vipr2 UTSW 12 116,058,344 (GRCm39) missense probably damaging 0.96
R9523:Vipr2 UTSW 12 116,093,788 (GRCm39) missense probably damaging 1.00
X0066:Vipr2 UTSW 12 116,106,565 (GRCm39) splice site probably null
X0067:Vipr2 UTSW 12 116,102,792 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGGCTCAAGATGGAGGTAG -3'
(R):5'- GGGTCAAGAGTCTAAACCTCTG -3'

Sequencing Primer
(F):5'- ATAAAATGACCCTGTCTCCTGTC -3'
(R):5'- TCAAGAGTCTAAACCTCTGAGTTACC -3'
Posted On 2019-11-26