Incidental Mutation 'R7763:Zfp808'
ID 598064
Institutional Source Beutler Lab
Gene Symbol Zfp808
Ensembl Gene ENSMUSG00000074867
Gene Name zinc finger protein 808
Synonyms Gm7036
MMRRC Submission 045819-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 62277674-62321752 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62320478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 569 (Q569L)
Ref Sequence ENSEMBL: ENSMUSP00000097048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]
AlphaFold B8JJZ4
Predicted Effect probably benign
Transcript: ENSMUST00000099449
AA Change: Q569L

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: Q569L

DomainStartEndE-ValueType
KRAB 4 66 2.1e-17 SMART
ZnF_C2H2 133 155 2.4e-3 SMART
ZnF_C2H2 161 183 8.34e-3 SMART
ZnF_C2H2 189 211 2.75e-3 SMART
ZnF_C2H2 217 239 1.98e-4 SMART
ZnF_C2H2 245 267 3.21e-4 SMART
ZnF_C2H2 273 295 2.43e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 4.54e-4 SMART
ZnF_C2H2 357 379 9.22e-5 SMART
ZnF_C2H2 385 407 8.22e-2 SMART
ZnF_C2H2 413 435 1.56e-2 SMART
ZnF_C2H2 441 463 5.99e-4 SMART
ZnF_C2H2 469 491 2.79e-4 SMART
ZnF_C2H2 497 519 4.54e-4 SMART
ZnF_C2H2 525 547 1.95e-3 SMART
ZnF_C2H2 553 575 4.24e-4 SMART
ZnF_C2H2 581 603 2.27e-4 SMART
ZnF_C2H2 609 631 2.27e-4 SMART
ZnF_C2H2 637 659 9.08e-4 SMART
ZnF_C2H2 665 687 1.4e-4 SMART
ZnF_C2H2 693 715 4.24e-4 SMART
ZnF_C2H2 721 743 1.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221772
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,113,825 (GRCm39) W899R probably damaging Het
Abca5 A T 11: 110,163,323 (GRCm39) W1631R possibly damaging Het
Actg2 T A 6: 83,504,350 (GRCm39) D25V probably damaging Het
Akap10 G C 11: 61,806,331 (GRCm39) D132E probably damaging Het
Angptl2 G T 2: 33,132,394 (GRCm39) E334* probably null Het
Aprt T C 8: 123,301,674 (GRCm39) R165G probably benign Het
Bmp1 A G 14: 70,729,524 (GRCm39) F549S probably damaging Het
Capzb C T 4: 139,007,864 (GRCm39) T215I probably benign Het
Car14 C T 3: 95,811,684 (GRCm39) M1I probably null Het
Ccdc148 T A 2: 58,713,648 (GRCm39) Q501L probably benign Het
Ccdc32 G A 2: 118,857,828 (GRCm39) T12I probably damaging Het
Ccnf G A 17: 24,443,986 (GRCm39) S594L probably damaging Het
Cdadc1 C T 14: 59,811,283 (GRCm39) C409Y probably damaging Het
Cdh23 G T 10: 60,148,356 (GRCm39) S2670R probably damaging Het
Cdh8 T A 8: 100,006,306 (GRCm39) K94* probably null Het
Cdhr2 A T 13: 54,865,505 (GRCm39) Y193F probably damaging Het
Cdon T A 9: 35,365,711 (GRCm39) Y153* probably null Het
Chd1 G A 17: 15,953,303 (GRCm39) G413R probably damaging Het
Cit A T 5: 116,125,060 (GRCm39) T1582S probably benign Het
Clec4a3 T C 6: 122,941,299 (GRCm39) L98P probably benign Het
Cpa4 T A 6: 30,583,644 (GRCm39) D253E probably damaging Het
Cyp2c40 T A 19: 39,795,612 (GRCm39) N189I possibly damaging Het
Daam2 G T 17: 49,797,050 (GRCm39) A245E probably benign Het
Dennd5b A G 6: 148,970,156 (GRCm39) F121S probably damaging Het
Dgkd A G 1: 87,854,671 (GRCm39) T658A probably benign Het
Dmwd T A 7: 18,814,265 (GRCm39) L305Q probably damaging Het
Dnah5 A T 15: 28,314,001 (GRCm39) Y1939F probably damaging Het
Dock5 T C 14: 68,058,776 (GRCm39) T512A probably damaging Het
Dop1b T A 16: 93,552,402 (GRCm39) D398E probably benign Het
Eef1akmt4 A G 16: 20,437,279 (GRCm39) H207R probably damaging Het
Egfr T C 11: 16,841,266 (GRCm39) V719A probably damaging Het
Ep300 A T 15: 81,470,784 (GRCm39) probably benign Het
Epha4 A G 1: 77,366,668 (GRCm39) probably null Het
Erc2 T G 14: 27,598,161 (GRCm39) probably null Het
Ergic1 A T 17: 26,857,801 (GRCm39) Y209F possibly damaging Het
Fbxw28 A G 9: 109,155,701 (GRCm39) I357T probably damaging Het
Flnb A T 14: 7,926,478 (GRCm38) T1841S probably benign Het
Foxc1 G A 13: 31,992,011 (GRCm39) S274N probably benign Het
Fto C T 8: 92,136,071 (GRCm39) T115M probably damaging Het
Gm10228 C G 16: 88,838,187 (GRCm39) C39S unknown Het
Gm7334 T C 17: 51,005,743 (GRCm39) F10L possibly damaging Het
Hfm1 A G 5: 107,029,727 (GRCm39) Y785H probably damaging Het
Hivep1 T A 13: 42,312,937 (GRCm39) S1726T probably benign Het
Htt G T 5: 35,009,534 (GRCm39) C1505F probably damaging Het
Hydin T C 8: 111,232,475 (GRCm39) S1665P possibly damaging Het
Ifi209 T A 1: 173,470,445 (GRCm39) N344K probably damaging Het
Ifnar2 T C 16: 91,196,181 (GRCm39) M262T probably benign Het
Ighv7-3 T A 12: 114,116,827 (GRCm39) S112C probably damaging Het
Igkv4-86 A G 6: 68,887,563 (GRCm39) S59P probably benign Het
Iglv1 A G 16: 18,904,239 (GRCm39) probably benign Het
Ipo7 T A 7: 109,652,006 (GRCm39) D928E possibly damaging Het
Itgae G T 11: 73,014,095 (GRCm39) probably null Het
Kbtbd12 T A 6: 88,595,179 (GRCm39) Q217L probably benign Het
Kcnma1 T A 14: 23,350,074 (GRCm39) Y1155F possibly damaging Het
Kif14 A G 1: 136,444,121 (GRCm39) E1371G probably benign Het
Lilrb4a A T 10: 51,367,142 (GRCm39) Y10F probably benign Het
Lrp2 A T 2: 69,333,732 (GRCm39) V1503E probably damaging Het
Mfsd6 A T 1: 52,747,799 (GRCm39) D355E probably benign Het
Mri1 T C 8: 84,977,657 (GRCm39) H226R Het
Mroh4 C T 15: 74,496,554 (GRCm39) E278K probably damaging Het
Muc4 T A 16: 32,574,739 (GRCm39) L1063H probably benign Het
Mzf1 A T 7: 12,778,018 (GRCm39) I541N probably damaging Het
Nasp T A 4: 116,469,230 (GRCm39) E116D probably benign Het
Nlrp10 T A 7: 108,525,033 (GRCm39) E149V probably damaging Het
Notch4 G A 17: 34,801,392 (GRCm39) C1080Y probably damaging Het
Nova1 T G 12: 46,767,481 (GRCm39) I147L unknown Het
Ogdh A G 11: 6,288,558 (GRCm39) M223V probably benign Het
Or2a56 T C 6: 42,932,723 (GRCm39) I97T probably benign Het
Or2y1e G T 11: 49,218,498 (GRCm39) A87S probably benign Het
Or4n4 A T 14: 50,518,945 (GRCm39) I255N probably damaging Het
Or6c66b G T 10: 129,377,324 (GRCm39) R306L probably benign Het
P3h3 T C 6: 124,831,395 (GRCm39) Q330R probably benign Het
Pcdhb10 A G 18: 37,544,935 (GRCm39) T4A not run Het
Pkd2l2 A T 18: 34,566,340 (GRCm39) probably null Het
Plekhb1 C T 7: 100,294,870 (GRCm39) V168I probably benign Het
Plxna4 C T 6: 32,200,915 (GRCm39) R753H probably damaging Het
Pramel17 T C 4: 101,694,338 (GRCm39) I182V possibly damaging Het
Prex1 G C 2: 166,555,629 (GRCm39) P4A unknown Het
Ptgdr A G 14: 45,096,535 (GRCm39) V59A probably damaging Het
Ralgapa1 T A 12: 55,804,740 (GRCm39) I519F probably benign Het
Rbpms A G 8: 34,279,481 (GRCm39) I170T probably benign Het
Sec31b T A 19: 44,512,274 (GRCm39) probably null Het
Skint11 A T 4: 114,084,905 (GRCm39) Y138F probably benign Het
Slain2 A G 5: 73,105,953 (GRCm39) Y196C probably damaging Het
Slco1b2 T A 6: 141,621,950 (GRCm39) C503* probably null Het
Slfn3 A T 11: 83,105,614 (GRCm39) Y537F possibly damaging Het
Slu7 T C 11: 43,335,592 (GRCm39) Y443H probably damaging Het
Sorl1 T A 9: 41,955,205 (GRCm39) E683D probably damaging Het
Sos1 T A 17: 80,721,142 (GRCm39) I893L probably benign Het
St8sia2 T A 7: 73,593,069 (GRCm39) Y329F probably damaging Het
Stra6l C A 4: 45,869,570 (GRCm39) S212* probably null Het
Syne3 C T 12: 104,963,754 (GRCm39) probably benign Het
Tenm4 T A 7: 96,544,899 (GRCm39) I2342N probably benign Het
Tescl T A 7: 24,032,688 (GRCm39) E212D probably benign Het
Trip11 A G 12: 101,811,114 (GRCm39) S1879P probably benign Het
Ube2c A T 2: 164,613,211 (GRCm39) probably null Het
Umodl1 T A 17: 31,205,430 (GRCm39) I675N probably benign Het
Vipr2 T C 12: 116,086,338 (GRCm39) F121S probably damaging Het
Vmn1r206 A T 13: 22,804,839 (GRCm39) S123T possibly damaging Het
Vmn1r58 A G 7: 5,413,912 (GRCm39) V106A probably damaging Het
Vmn2r112 A G 17: 22,822,099 (GRCm39) Y259C probably damaging Het
Vmn2r66 T C 7: 84,654,909 (GRCm39) K467E probably benign Het
Vmn2r98 T C 17: 19,300,797 (GRCm39) F600L probably benign Het
Vps13a T A 19: 16,723,364 (GRCm39) N278I possibly damaging Het
Vwa5a A C 9: 38,652,458 (GRCm39) D747A possibly damaging Het
Xdh G A 17: 74,241,829 (GRCm39) P157S possibly damaging Het
Xrn1 G A 9: 95,880,401 (GRCm39) probably null Het
Zfp362 T A 4: 128,680,824 (GRCm39) H180L probably benign Het
Zfp560 A T 9: 20,258,619 (GRCm39) W748R possibly damaging Het
Zfp93 T A 7: 23,974,643 (GRCm39) D209E possibly damaging Het
Zftraf1 A T 15: 76,542,747 (GRCm39) Y138N probably damaging Het
Other mutations in Zfp808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Zfp808 APN 13 62,321,023 (GRCm39) missense probably damaging 0.96
IGL02517:Zfp808 APN 13 62,321,032 (GRCm39) makesense probably null
IGL02809:Zfp808 APN 13 62,320,994 (GRCm39) missense probably benign 0.00
IGL02882:Zfp808 APN 13 62,320,994 (GRCm39) missense probably benign 0.00
IGL02941:Zfp808 APN 13 62,320,944 (GRCm39) missense possibly damaging 0.82
IGL03184:Zfp808 APN 13 62,317,381 (GRCm39) missense possibly damaging 0.90
LCD18:Zfp808 UTSW 13 62,314,465 (GRCm39) intron probably benign
R0387:Zfp808 UTSW 13 62,317,292 (GRCm39) missense probably damaging 1.00
R0472:Zfp808 UTSW 13 62,320,120 (GRCm39) missense probably damaging 1.00
R0544:Zfp808 UTSW 13 62,317,248 (GRCm39) splice site probably benign
R0635:Zfp808 UTSW 13 62,320,233 (GRCm39) missense probably damaging 1.00
R0981:Zfp808 UTSW 13 62,319,487 (GRCm39) missense possibly damaging 0.47
R1446:Zfp808 UTSW 13 62,320,821 (GRCm39) missense probably damaging 1.00
R1569:Zfp808 UTSW 13 62,320,714 (GRCm39) nonsense probably null
R1573:Zfp808 UTSW 13 62,319,311 (GRCm39) missense possibly damaging 0.52
R1761:Zfp808 UTSW 13 62,319,460 (GRCm39) missense possibly damaging 0.71
R1796:Zfp808 UTSW 13 62,319,670 (GRCm39) missense probably damaging 1.00
R1993:Zfp808 UTSW 13 62,320,721 (GRCm39) missense probably benign 0.10
R2656:Zfp808 UTSW 13 62,320,666 (GRCm39) missense possibly damaging 0.63
R2938:Zfp808 UTSW 13 62,319,032 (GRCm39) missense probably benign
R3027:Zfp808 UTSW 13 62,319,404 (GRCm39) missense probably benign 0.33
R3777:Zfp808 UTSW 13 62,319,717 (GRCm39) missense probably damaging 0.97
R3779:Zfp808 UTSW 13 62,319,717 (GRCm39) missense probably damaging 0.97
R3801:Zfp808 UTSW 13 62,319,897 (GRCm39) missense probably damaging 1.00
R3802:Zfp808 UTSW 13 62,319,897 (GRCm39) missense probably damaging 1.00
R3804:Zfp808 UTSW 13 62,319,897 (GRCm39) missense probably damaging 1.00
R4024:Zfp808 UTSW 13 62,319,544 (GRCm39) missense possibly damaging 0.71
R4741:Zfp808 UTSW 13 62,319,763 (GRCm39) missense probably damaging 1.00
R4791:Zfp808 UTSW 13 62,319,045 (GRCm39) missense probably damaging 0.97
R4809:Zfp808 UTSW 13 62,319,106 (GRCm39) nonsense probably null
R4907:Zfp808 UTSW 13 62,319,287 (GRCm39) missense possibly damaging 0.71
R5056:Zfp808 UTSW 13 62,320,444 (GRCm39) missense probably damaging 1.00
R5760:Zfp808 UTSW 13 62,319,740 (GRCm39) missense probably damaging 1.00
R5869:Zfp808 UTSW 13 62,319,069 (GRCm39) missense probably damaging 1.00
R6230:Zfp808 UTSW 13 62,320,136 (GRCm39) missense probably benign 0.19
R6372:Zfp808 UTSW 13 62,320,291 (GRCm39) missense probably damaging 1.00
R6545:Zfp808 UTSW 13 62,319,709 (GRCm39) missense probably benign 0.02
R6620:Zfp808 UTSW 13 62,320,638 (GRCm39) missense probably benign 0.08
R6622:Zfp808 UTSW 13 62,319,646 (GRCm39) missense possibly damaging 0.90
R6813:Zfp808 UTSW 13 62,320,849 (GRCm39) missense probably damaging 0.99
R6920:Zfp808 UTSW 13 62,320,982 (GRCm39) missense probably benign 0.05
R7511:Zfp808 UTSW 13 62,320,637 (GRCm39) missense probably benign
R7666:Zfp808 UTSW 13 62,319,225 (GRCm39) missense probably benign
R7747:Zfp808 UTSW 13 62,319,319 (GRCm39) missense probably benign 0.39
R7779:Zfp808 UTSW 13 62,320,571 (GRCm39) missense possibly damaging 0.68
R8147:Zfp808 UTSW 13 62,320,934 (GRCm39) missense probably damaging 1.00
R8182:Zfp808 UTSW 13 62,319,521 (GRCm39) missense probably damaging 0.96
R8260:Zfp808 UTSW 13 62,320,552 (GRCm39) missense probably benign 0.01
R8434:Zfp808 UTSW 13 62,319,926 (GRCm39) missense probably damaging 1.00
R8822:Zfp808 UTSW 13 62,320,869 (GRCm39) missense probably damaging 1.00
R9330:Zfp808 UTSW 13 62,319,974 (GRCm39) missense probably benign 0.00
R9564:Zfp808 UTSW 13 62,320,661 (GRCm39) missense possibly damaging 0.49
RF005:Zfp808 UTSW 13 62,319,113 (GRCm39) missense probably benign 0.14
RF024:Zfp808 UTSW 13 62,319,113 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATACTGGAGAGAAGCCCTTCA -3'
(R):5'- TCTCTCCAGTATGTGTTCTTCTATGAG -3'

Sequencing Primer
(F):5'- GCCCTTCAAATGTAATCAGTGTG -3'
(R):5'- ACATTTGAAGGGTTTCTCTCCAG -3'
Posted On 2019-11-26