Incidental Mutation 'R7763:Kcnma1'
ID 598066
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Name potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms MaxiK, BKCa, 5730414M22Rik, BK channel alpha subunit, Slo, Slo1, mSlo1
MMRRC Submission 045819-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.856) question?
Stock # R7763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 23342356-24055173 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23350074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1155 (Y1155F)
Ref Sequence ENSEMBL: ENSMUSP00000141069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000188210] [ENSMUST00000179836] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000224077] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225556] [ENSMUST00000225794]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065788
AA Change: Y1071F

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: Y1071F

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074983
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112423
AA Change: Y1018F

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: Y1018F

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145596
Predicted Effect probably benign
Transcript: ENSMUST00000172099
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177634
AA Change: Y1098F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: Y1098F

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179097
AA Change: Y1095F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: Y1095F

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188210
AA Change: Y1155F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: Y1155F

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179836
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188285
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188991
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190044
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190985
Predicted Effect probably benign
Transcript: ENSMUST00000223655
Predicted Effect probably benign
Transcript: ENSMUST00000223727
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000224077
Predicted Effect probably benign
Transcript: ENSMUST00000224468
Predicted Effect probably benign
Transcript: ENSMUST00000224787
AA Change: Y1078F

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000225315
Predicted Effect probably benign
Transcript: ENSMUST00000225431
AA Change: Y1128F

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000225556
Predicted Effect probably benign
Transcript: ENSMUST00000225794
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,113,825 (GRCm39) W899R probably damaging Het
Abca5 A T 11: 110,163,323 (GRCm39) W1631R possibly damaging Het
Actg2 T A 6: 83,504,350 (GRCm39) D25V probably damaging Het
Akap10 G C 11: 61,806,331 (GRCm39) D132E probably damaging Het
Angptl2 G T 2: 33,132,394 (GRCm39) E334* probably null Het
Aprt T C 8: 123,301,674 (GRCm39) R165G probably benign Het
Bmp1 A G 14: 70,729,524 (GRCm39) F549S probably damaging Het
Capzb C T 4: 139,007,864 (GRCm39) T215I probably benign Het
Car14 C T 3: 95,811,684 (GRCm39) M1I probably null Het
Ccdc148 T A 2: 58,713,648 (GRCm39) Q501L probably benign Het
Ccdc32 G A 2: 118,857,828 (GRCm39) T12I probably damaging Het
Ccnf G A 17: 24,443,986 (GRCm39) S594L probably damaging Het
Cdadc1 C T 14: 59,811,283 (GRCm39) C409Y probably damaging Het
Cdh23 G T 10: 60,148,356 (GRCm39) S2670R probably damaging Het
Cdh8 T A 8: 100,006,306 (GRCm39) K94* probably null Het
Cdhr2 A T 13: 54,865,505 (GRCm39) Y193F probably damaging Het
Cdon T A 9: 35,365,711 (GRCm39) Y153* probably null Het
Chd1 G A 17: 15,953,303 (GRCm39) G413R probably damaging Het
Cit A T 5: 116,125,060 (GRCm39) T1582S probably benign Het
Clec4a3 T C 6: 122,941,299 (GRCm39) L98P probably benign Het
Cpa4 T A 6: 30,583,644 (GRCm39) D253E probably damaging Het
Cyp2c40 T A 19: 39,795,612 (GRCm39) N189I possibly damaging Het
Daam2 G T 17: 49,797,050 (GRCm39) A245E probably benign Het
Dennd5b A G 6: 148,970,156 (GRCm39) F121S probably damaging Het
Dgkd A G 1: 87,854,671 (GRCm39) T658A probably benign Het
Dmwd T A 7: 18,814,265 (GRCm39) L305Q probably damaging Het
Dnah5 A T 15: 28,314,001 (GRCm39) Y1939F probably damaging Het
Dock5 T C 14: 68,058,776 (GRCm39) T512A probably damaging Het
Dop1b T A 16: 93,552,402 (GRCm39) D398E probably benign Het
Eef1akmt4 A G 16: 20,437,279 (GRCm39) H207R probably damaging Het
Egfr T C 11: 16,841,266 (GRCm39) V719A probably damaging Het
Ep300 A T 15: 81,470,784 (GRCm39) probably benign Het
Epha4 A G 1: 77,366,668 (GRCm39) probably null Het
Erc2 T G 14: 27,598,161 (GRCm39) probably null Het
Ergic1 A T 17: 26,857,801 (GRCm39) Y209F possibly damaging Het
Fbxw28 A G 9: 109,155,701 (GRCm39) I357T probably damaging Het
Flnb A T 14: 7,926,478 (GRCm38) T1841S probably benign Het
Foxc1 G A 13: 31,992,011 (GRCm39) S274N probably benign Het
Fto C T 8: 92,136,071 (GRCm39) T115M probably damaging Het
Gm10228 C G 16: 88,838,187 (GRCm39) C39S unknown Het
Gm7334 T C 17: 51,005,743 (GRCm39) F10L possibly damaging Het
Hfm1 A G 5: 107,029,727 (GRCm39) Y785H probably damaging Het
Hivep1 T A 13: 42,312,937 (GRCm39) S1726T probably benign Het
Htt G T 5: 35,009,534 (GRCm39) C1505F probably damaging Het
Hydin T C 8: 111,232,475 (GRCm39) S1665P possibly damaging Het
Ifi209 T A 1: 173,470,445 (GRCm39) N344K probably damaging Het
Ifnar2 T C 16: 91,196,181 (GRCm39) M262T probably benign Het
Ighv7-3 T A 12: 114,116,827 (GRCm39) S112C probably damaging Het
Igkv4-86 A G 6: 68,887,563 (GRCm39) S59P probably benign Het
Iglv1 A G 16: 18,904,239 (GRCm39) probably benign Het
Ipo7 T A 7: 109,652,006 (GRCm39) D928E possibly damaging Het
Itgae G T 11: 73,014,095 (GRCm39) probably null Het
Kbtbd12 T A 6: 88,595,179 (GRCm39) Q217L probably benign Het
Kif14 A G 1: 136,444,121 (GRCm39) E1371G probably benign Het
Lilrb4a A T 10: 51,367,142 (GRCm39) Y10F probably benign Het
Lrp2 A T 2: 69,333,732 (GRCm39) V1503E probably damaging Het
Mfsd6 A T 1: 52,747,799 (GRCm39) D355E probably benign Het
Mri1 T C 8: 84,977,657 (GRCm39) H226R Het
Mroh4 C T 15: 74,496,554 (GRCm39) E278K probably damaging Het
Muc4 T A 16: 32,574,739 (GRCm39) L1063H probably benign Het
Mzf1 A T 7: 12,778,018 (GRCm39) I541N probably damaging Het
Nasp T A 4: 116,469,230 (GRCm39) E116D probably benign Het
Nlrp10 T A 7: 108,525,033 (GRCm39) E149V probably damaging Het
Notch4 G A 17: 34,801,392 (GRCm39) C1080Y probably damaging Het
Nova1 T G 12: 46,767,481 (GRCm39) I147L unknown Het
Ogdh A G 11: 6,288,558 (GRCm39) M223V probably benign Het
Or2a56 T C 6: 42,932,723 (GRCm39) I97T probably benign Het
Or2y1e G T 11: 49,218,498 (GRCm39) A87S probably benign Het
Or4n4 A T 14: 50,518,945 (GRCm39) I255N probably damaging Het
Or6c66b G T 10: 129,377,324 (GRCm39) R306L probably benign Het
P3h3 T C 6: 124,831,395 (GRCm39) Q330R probably benign Het
Pcdhb10 A G 18: 37,544,935 (GRCm39) T4A not run Het
Pkd2l2 A T 18: 34,566,340 (GRCm39) probably null Het
Plekhb1 C T 7: 100,294,870 (GRCm39) V168I probably benign Het
Plxna4 C T 6: 32,200,915 (GRCm39) R753H probably damaging Het
Pramel17 T C 4: 101,694,338 (GRCm39) I182V possibly damaging Het
Prex1 G C 2: 166,555,629 (GRCm39) P4A unknown Het
Ptgdr A G 14: 45,096,535 (GRCm39) V59A probably damaging Het
Ralgapa1 T A 12: 55,804,740 (GRCm39) I519F probably benign Het
Rbpms A G 8: 34,279,481 (GRCm39) I170T probably benign Het
Sec31b T A 19: 44,512,274 (GRCm39) probably null Het
Skint11 A T 4: 114,084,905 (GRCm39) Y138F probably benign Het
Slain2 A G 5: 73,105,953 (GRCm39) Y196C probably damaging Het
Slco1b2 T A 6: 141,621,950 (GRCm39) C503* probably null Het
Slfn3 A T 11: 83,105,614 (GRCm39) Y537F possibly damaging Het
Slu7 T C 11: 43,335,592 (GRCm39) Y443H probably damaging Het
Sorl1 T A 9: 41,955,205 (GRCm39) E683D probably damaging Het
Sos1 T A 17: 80,721,142 (GRCm39) I893L probably benign Het
St8sia2 T A 7: 73,593,069 (GRCm39) Y329F probably damaging Het
Stra6l C A 4: 45,869,570 (GRCm39) S212* probably null Het
Syne3 C T 12: 104,963,754 (GRCm39) probably benign Het
Tenm4 T A 7: 96,544,899 (GRCm39) I2342N probably benign Het
Tescl T A 7: 24,032,688 (GRCm39) E212D probably benign Het
Trip11 A G 12: 101,811,114 (GRCm39) S1879P probably benign Het
Ube2c A T 2: 164,613,211 (GRCm39) probably null Het
Umodl1 T A 17: 31,205,430 (GRCm39) I675N probably benign Het
Vipr2 T C 12: 116,086,338 (GRCm39) F121S probably damaging Het
Vmn1r206 A T 13: 22,804,839 (GRCm39) S123T possibly damaging Het
Vmn1r58 A G 7: 5,413,912 (GRCm39) V106A probably damaging Het
Vmn2r112 A G 17: 22,822,099 (GRCm39) Y259C probably damaging Het
Vmn2r66 T C 7: 84,654,909 (GRCm39) K467E probably benign Het
Vmn2r98 T C 17: 19,300,797 (GRCm39) F600L probably benign Het
Vps13a T A 19: 16,723,364 (GRCm39) N278I possibly damaging Het
Vwa5a A C 9: 38,652,458 (GRCm39) D747A possibly damaging Het
Xdh G A 17: 74,241,829 (GRCm39) P157S possibly damaging Het
Xrn1 G A 9: 95,880,401 (GRCm39) probably null Het
Zfp362 T A 4: 128,680,824 (GRCm39) H180L probably benign Het
Zfp560 A T 9: 20,258,619 (GRCm39) W748R possibly damaging Het
Zfp808 A T 13: 62,320,478 (GRCm39) Q569L probably benign Het
Zfp93 T A 7: 23,974,643 (GRCm39) D209E possibly damaging Het
Zftraf1 A T 15: 76,542,747 (GRCm39) Y138N probably damaging Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23,364,390 (GRCm39) splice site probably benign
IGL01520:Kcnma1 APN 14 23,551,211 (GRCm39) missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23,580,367 (GRCm39) splice site probably benign
IGL02140:Kcnma1 APN 14 23,359,113 (GRCm39) missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23,387,035 (GRCm39) missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23,576,881 (GRCm39) missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23,593,144 (GRCm39) missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23,641,681 (GRCm39) missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23,641,681 (GRCm39) missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23,361,757 (GRCm39) missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23,436,327 (GRCm39) critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23,413,900 (GRCm39) missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23,513,224 (GRCm39) missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23,359,222 (GRCm39) missense probably damaging 1.00
G1citation:Kcnma1 UTSW 14 24,053,812 (GRCm39) splice site probably null
PIT4495001:Kcnma1 UTSW 14 23,475,665 (GRCm39) missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23,359,103 (GRCm39) splice site probably null
PIT4576001:Kcnma1 UTSW 14 23,359,103 (GRCm39) splice site probably null
R0071:Kcnma1 UTSW 14 23,576,835 (GRCm39) missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23,576,835 (GRCm39) missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23,364,243 (GRCm39) missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23,853,234 (GRCm39) missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23,576,835 (GRCm39) missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23,558,120 (GRCm39) missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23,544,647 (GRCm39) missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23,544,647 (GRCm39) missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23,423,265 (GRCm39) missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23,361,784 (GRCm39) missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23,559,852 (GRCm39) splice site probably benign
R0668:Kcnma1 UTSW 14 23,417,563 (GRCm39) missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23,350,086 (GRCm39) missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23,350,086 (GRCm39) missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23,544,675 (GRCm39) missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23,417,710 (GRCm39) missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23,361,792 (GRCm39) missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23,513,268 (GRCm39) missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23,364,262 (GRCm39) missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23,380,997 (GRCm39) missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23,380,997 (GRCm39) missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23,380,997 (GRCm39) missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23,853,230 (GRCm39) missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23,387,097 (GRCm39) missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23,364,288 (GRCm39) missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23,593,151 (GRCm39) nonsense probably null
R2866:Kcnma1 UTSW 14 23,423,275 (GRCm39) missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23,423,275 (GRCm39) missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23,423,275 (GRCm39) missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23,853,228 (GRCm39) missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23,350,006 (GRCm39) missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23,417,679 (GRCm39) missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23,555,323 (GRCm39) missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24,053,815 (GRCm39) critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24,053,815 (GRCm39) critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23,361,720 (GRCm39) missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23,387,097 (GRCm39) missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23,853,228 (GRCm39) missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23,359,106 (GRCm39) critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23,853,270 (GRCm39) missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23,413,904 (GRCm39) missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23,359,220 (GRCm39) missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24,054,186 (GRCm39) intron probably benign
R5175:Kcnma1 UTSW 14 23,386,106 (GRCm39) critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23,513,253 (GRCm39) missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23,578,472 (GRCm39) nonsense probably null
R5705:Kcnma1 UTSW 14 24,053,839 (GRCm39) missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23,544,635 (GRCm39) missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23,436,419 (GRCm39) nonsense probably null
R5793:Kcnma1 UTSW 14 23,359,103 (GRCm39) splice site probably null
R6039:Kcnma1 UTSW 14 23,359,105 (GRCm39) missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23,359,105 (GRCm39) missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24,053,936 (GRCm39) missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23,559,957 (GRCm39) missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23,386,165 (GRCm39) missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24,052,882 (GRCm39) nonsense probably null
R6822:Kcnma1 UTSW 14 24,053,812 (GRCm39) splice site probably null
R6855:Kcnma1 UTSW 14 23,417,679 (GRCm39) missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23,576,602 (GRCm39) critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23,544,711 (GRCm39) missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23,350,086 (GRCm39) missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23,513,224 (GRCm39) missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23,417,562 (GRCm39) missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23,576,691 (GRCm39) missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23,359,083 (GRCm39) makesense probably null
R7308:Kcnma1 UTSW 14 23,381,003 (GRCm39) missense probably damaging 0.99
R7371:Kcnma1 UTSW 14 23,544,638 (GRCm39) missense possibly damaging 0.94
R7404:Kcnma1 UTSW 14 24,052,902 (GRCm39) missense unknown
R7560:Kcnma1 UTSW 14 23,580,310 (GRCm39) missense probably benign 0.15
R7693:Kcnma1 UTSW 14 23,417,680 (GRCm39) missense probably damaging 1.00
R7809:Kcnma1 UTSW 14 23,423,324 (GRCm39) missense probably benign 0.16
R7832:Kcnma1 UTSW 14 23,440,991 (GRCm39) missense probably benign
R7884:Kcnma1 UTSW 14 23,387,057 (GRCm39) missense probably benign 0.01
R8013:Kcnma1 UTSW 14 23,423,211 (GRCm39) missense probably benign 0.31
R8014:Kcnma1 UTSW 14 23,423,211 (GRCm39) missense probably benign 0.31
R8066:Kcnma1 UTSW 14 23,361,744 (GRCm39) missense probably benign 0.00
R8097:Kcnma1 UTSW 14 23,381,032 (GRCm39) missense probably damaging 1.00
R8154:Kcnma1 UTSW 14 23,361,822 (GRCm39) missense possibly damaging 0.62
R8507:Kcnma1 UTSW 14 23,641,706 (GRCm39) missense probably benign 0.00
R8672:Kcnma1 UTSW 14 23,551,230 (GRCm39) missense probably damaging 1.00
R8677:Kcnma1 UTSW 14 23,436,418 (GRCm39) missense probably benign 0.36
R8725:Kcnma1 UTSW 14 23,436,332 (GRCm39) missense probably benign 0.00
R8727:Kcnma1 UTSW 14 23,436,332 (GRCm39) missense probably benign 0.00
R8827:Kcnma1 UTSW 14 23,417,548 (GRCm39) missense probably damaging 1.00
R8880:Kcnma1 UTSW 14 23,417,718 (GRCm39) missense probably damaging 1.00
R8997:Kcnma1 UTSW 14 23,513,037 (GRCm39) intron probably benign
R9056:Kcnma1 UTSW 14 23,700,214 (GRCm39) missense possibly damaging 0.80
R9346:Kcnma1 UTSW 14 23,700,233 (GRCm39) missense possibly damaging 0.94
R9403:Kcnma1 UTSW 14 23,593,145 (GRCm39) missense probably benign 0.05
R9438:Kcnma1 UTSW 14 23,417,653 (GRCm39) missense probably benign 0.00
R9482:Kcnma1 UTSW 14 23,441,033 (GRCm39) missense probably benign
R9511:Kcnma1 UTSW 14 23,361,793 (GRCm39) missense possibly damaging 0.90
R9649:Kcnma1 UTSW 14 23,501,666 (GRCm39) critical splice donor site probably null
R9663:Kcnma1 UTSW 14 24,053,897 (GRCm39) missense probably benign 0.15
R9673:Kcnma1 UTSW 14 23,558,123 (GRCm39) missense probably benign 0.01
RF001:Kcnma1 UTSW 14 23,361,765 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTGATTCAGCATGTAAGAG -3'
(R):5'- GGGCTTCTGTACACTGCATTTC -3'

Sequencing Primer
(F):5'- GAAAAGTCACGTCACCATTTATGAAG -3'
(R):5'- CTTAGCAATTACTCACTGCCGG -3'
Posted On 2019-11-26