Incidental Mutation 'R7763:Kcnma1'
ID598066
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R7763 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23300006 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1155 (Y1155F)
Ref Sequence ENSEMBL: ENSMUSP00000141069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000224077] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225556] [ENSMUST00000225794]
Predicted Effect probably benign
Transcript: ENSMUST00000065788
AA Change: Y1071F

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: Y1071F

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074983
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112423
AA Change: Y1018F

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: Y1018F

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145596
Predicted Effect probably benign
Transcript: ENSMUST00000172099
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177634
AA Change: Y1098F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: Y1098F

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179097
AA Change: Y1095F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: Y1095F

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179836
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188210
AA Change: Y1155F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: Y1155F

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188285
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188991
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190044
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190985
Predicted Effect probably benign
Transcript: ENSMUST00000223655
Predicted Effect probably benign
Transcript: ENSMUST00000223727
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000224077
Predicted Effect probably benign
Transcript: ENSMUST00000224468
Predicted Effect probably benign
Transcript: ENSMUST00000224787
AA Change: Y1078F

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000225315
Predicted Effect probably benign
Transcript: ENSMUST00000225431
AA Change: Y1128F

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000225556
Predicted Effect probably benign
Transcript: ENSMUST00000225794
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,514,602 W899R probably damaging Het
Abca5 A T 11: 110,272,497 W1631R possibly damaging Het
Actg2 T A 6: 83,527,368 D25V probably damaging Het
Akap10 G C 11: 61,915,505 D132E probably damaging Het
Angptl2 G T 2: 33,242,382 E334* probably null Het
Aprt T C 8: 122,574,935 R165G probably benign Het
B020004J07Rik T C 4: 101,837,141 I182V possibly damaging Het
Bmp1 A G 14: 70,492,084 F549S probably damaging Het
Capzb C T 4: 139,280,553 T215I probably benign Het
Car14 C T 3: 95,904,372 M1I probably null Het
Ccdc148 T A 2: 58,823,636 Q501L probably benign Het
Ccdc32 G A 2: 119,027,347 T12I probably damaging Het
Ccnf G A 17: 24,225,012 S594L probably damaging Het
Cdadc1 C T 14: 59,573,834 C409Y probably damaging Het
Cdh23 G T 10: 60,312,577 S2670R probably damaging Het
Cdh8 T A 8: 99,279,674 K94* probably null Het
Cdhr2 A T 13: 54,717,692 Y193F probably damaging Het
Cdon T A 9: 35,454,415 Y153* probably null Het
Chd1 G A 17: 15,733,041 G413R probably damaging Het
Cit A T 5: 115,987,001 T1582S probably benign Het
Clec4a3 T C 6: 122,964,340 L98P probably benign Het
Cpa4 T A 6: 30,583,645 D253E probably damaging Het
Cyhr1 A T 15: 76,658,547 Y138N probably damaging Het
Cyp2c40 T A 19: 39,807,168 N189I possibly damaging Het
Daam2 G T 17: 49,490,022 A245E probably benign Het
Dennd5b A G 6: 149,068,658 F121S probably damaging Het
Dgkd A G 1: 87,926,949 T658A probably benign Het
Dmwd T A 7: 19,080,340 L305Q probably damaging Het
Dnah5 A T 15: 28,313,855 Y1939F probably damaging Het
Dock5 T C 14: 67,821,327 T512A probably damaging Het
Dopey2 T A 16: 93,755,514 D398E probably benign Het
Eef1akmt4 A G 16: 20,618,529 H207R probably damaging Het
Egfr T C 11: 16,891,266 V719A probably damaging Het
Ep300 A T 15: 81,586,583 probably benign Het
Epha4 A G 1: 77,390,031 probably null Het
Erc2 T G 14: 27,876,204 probably null Het
Ergic1 A T 17: 26,638,827 Y209F possibly damaging Het
Fbxw28 A G 9: 109,326,633 I357T probably damaging Het
Flnb A T 14: 7,926,478 T1841S probably benign Het
Foxc1 G A 13: 31,808,028 S274N probably benign Het
Fto C T 8: 91,409,443 T115M probably damaging Het
Gm10228 C G 16: 89,041,299 C39S unknown Het
Gm7334 T C 17: 50,698,715 F10L possibly damaging Het
Hfm1 A G 5: 106,881,861 Y785H probably damaging Het
Hivep1 T A 13: 42,159,461 S1726T probably benign Het
Htt G T 5: 34,852,190 C1505F probably damaging Het
Hydin T C 8: 110,505,843 S1665P possibly damaging Het
Ifi209 T A 1: 173,642,879 N344K probably damaging Het
Ifnar2 T C 16: 91,399,293 M262T probably benign Het
Ighv7-3 T A 12: 114,153,207 S112C probably damaging Het
Igkv4-86 A G 6: 68,910,579 S59P probably benign Het
Iglv1 A G 16: 19,085,489 probably benign Het
Ipo7 T A 7: 110,052,799 D928E possibly damaging Het
Itgae G T 11: 73,123,269 probably null Het
Kbtbd12 T A 6: 88,618,197 Q217L probably benign Het
Kif14 A G 1: 136,516,383 E1371G probably benign Het
Lilrb4a A T 10: 51,491,046 Y10F probably benign Het
Lrp2 A T 2: 69,503,388 V1503E probably damaging Het
Mfsd6 A T 1: 52,708,640 D355E probably benign Het
Mri1 T C 8: 84,251,028 H226R Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Muc4 T A 16: 32,753,311 L1063H probably benign Het
Mzf1 A T 7: 13,044,091 I541N probably damaging Het
Nasp T A 4: 116,612,033 E116D probably benign Het
Nlrp10 T A 7: 108,925,826 E149V probably damaging Het
Notch4 G A 17: 34,582,418 C1080Y probably damaging Het
Nova1 T G 12: 46,720,698 I147L unknown Het
Ogdh A G 11: 6,338,558 M223V probably benign Het
Olfr1391 G T 11: 49,327,671 A87S probably benign Het
Olfr444 T C 6: 42,955,789 I97T probably benign Het
Olfr732 A T 14: 50,281,488 I255N probably damaging Het
Olfr792 G T 10: 129,541,455 R306L probably benign Het
P3h3 T C 6: 124,854,432 Q330R probably benign Het
Pcdhb10 A G 18: 37,411,882 T4A not run Het
Pkd2l2 A T 18: 34,433,287 probably null Het
Plekhb1 C T 7: 100,645,663 V168I probably benign Het
Plxna4 C T 6: 32,223,980 R753H probably damaging Het
Prex1 G C 2: 166,713,709 P4A unknown Het
Ptgdr A G 14: 44,859,078 V59A probably damaging Het
Ralgapa1 T A 12: 55,757,955 I519F probably benign Het
Rbpms A G 8: 33,789,453 I170T probably benign Het
Sec31b T A 19: 44,523,835 probably null Het
Skint11 A T 4: 114,227,708 Y138F probably benign Het
Slain2 A G 5: 72,948,610 Y196C probably damaging Het
Slco1b2 T A 6: 141,676,224 C503* probably null Het
Slfn3 A T 11: 83,214,788 Y537F possibly damaging Het
Slu7 T C 11: 43,444,765 Y443H probably damaging Het
Sorl1 T A 9: 42,043,909 E683D probably damaging Het
Sos1 T A 17: 80,413,713 I893L probably benign Het
St8sia2 T A 7: 73,943,321 Y329F probably damaging Het
Stra6l C A 4: 45,869,570 S212* probably null Het
Syne3 C T 12: 104,997,495 probably benign Het
Tenm4 T A 7: 96,895,692 I2342N probably benign Het
Tescl T A 7: 24,333,263 E212D probably benign Het
Trip11 A G 12: 101,844,855 S1879P probably benign Het
Ube2c A T 2: 164,771,291 probably null Het
Umodl1 T A 17: 30,986,456 I675N probably benign Het
Vipr2 T C 12: 116,122,718 F121S probably damaging Het
Vmn1r206 A T 13: 22,620,669 S123T possibly damaging Het
Vmn1r58 A G 7: 5,410,913 V106A probably damaging Het
Vmn2r112 A G 17: 22,603,118 Y259C probably damaging Het
Vmn2r66 T C 7: 85,005,701 K467E probably benign Het
Vmn2r98 T C 17: 19,080,535 F600L probably benign Het
Vps13a T A 19: 16,746,000 N278I possibly damaging Het
Vwa5a A C 9: 38,741,162 D747A possibly damaging Het
Xdh G A 17: 73,934,834 P157S possibly damaging Het
Xrn1 G A 9: 95,998,348 probably null Het
Zfp362 T A 4: 128,787,031 H180L probably benign Het
Zfp560 A T 9: 20,347,323 W748R possibly damaging Het
Zfp808 A T 13: 62,172,664 Q569L probably benign Het
Zfp93 T A 7: 24,275,218 D209E possibly damaging Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
PIT4495001:Kcnma1 UTSW 14 23425597 missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23309035 splice site probably null
PIT4576001:Kcnma1 UTSW 14 23309035 splice site probably null
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23314175 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23803162 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5705:Kcnma1 UTSW 14 24003771 missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23386351 nonsense probably null
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23494643 missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23463156 missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23367494 missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23526623 missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23309015 makesense probably null
R7308:Kcnma1 UTSW 14 23330935 missense probably damaging 0.99
R7371:Kcnma1 UTSW 14 23494570 missense possibly damaging 0.94
R7404:Kcnma1 UTSW 14 24002834 missense unknown
R7560:Kcnma1 UTSW 14 23530242 missense probably benign 0.15
R7693:Kcnma1 UTSW 14 23367612 missense probably damaging 1.00
R7809:Kcnma1 UTSW 14 23373256 missense probably benign 0.16
R7832:Kcnma1 UTSW 14 23390923 missense probably benign
R7884:Kcnma1 UTSW 14 23336989 missense probably benign 0.01
R8013:Kcnma1 UTSW 14 23373143 missense probably benign 0.31
R8014:Kcnma1 UTSW 14 23373143 missense probably benign 0.31
R8066:Kcnma1 UTSW 14 23311676 missense probably benign 0.00
R8097:Kcnma1 UTSW 14 23330964 missense probably damaging 1.00
R8154:Kcnma1 UTSW 14 23311754 missense possibly damaging 0.62
RF001:Kcnma1 UTSW 14 23311697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTGATTCAGCATGTAAGAG -3'
(R):5'- GGGCTTCTGTACACTGCATTTC -3'

Sequencing Primer
(F):5'- GAAAAGTCACGTCACCATTTATGAAG -3'
(R):5'- CTTAGCAATTACTCACTGCCGG -3'
Posted On2019-11-26