Mutagenetix > Incidental Mutation

Incidental Mutation 'R7763:Muc4'

598079

Institutional Source

Beutler Lab

Gene Symbol

Muc4

Ensembl Gene

ENSMUSG00000079620

Gene Name

mucin 4

Synonyms

4933405I11Rik

MMRRC Submission

Accession Numbers

Genbank: NM_080457; MGI: 2153525

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R7763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32735886-32782391 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32753311 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1063 (L1063H)

Ref Sequence

ENSEMBL: ENSMUSP00000093813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000096106
AA Change: L1063H

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: L1063H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	37	65	N/A	INTRINSIC
low complexity region	86	111	N/A	INTRINSIC
internal_repeat_2	119	903	6.07e-127	PROSPERO
internal_repeat_1	164	987	3.47e-144	PROSPERO
internal_repeat_2	979	1875	6.07e-127	PROSPERO
internal_repeat_1	1193	2087	3.47e-144	PROSPERO
low complexity region	2090	2106	N/A	INTRINSIC
low complexity region	2111	2119	N/A	INTRINSIC
low complexity region	2186	2195	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2324	2332	N/A	INTRINSIC
low complexity region	2344	2367	N/A	INTRINSIC
NIDO	2458	2615	8.33e-67	SMART
AMOP	2614	2726	1.29e-47	SMART
VWD	2729	2910	4.23e-26	SMART
EGF_like	3134	3166	3.23e1	SMART
EGF_like	3176	3212	3.5e1	SMART
low complexity region	3237	3251	N/A	INTRINSIC
EGF	3384	3421	1.4e0	SMART
transmembrane domain	3430	3452	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132475

SMART Domains

Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620

Domain	Start	End	E-Value	Type
low complexity region	38	45	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	99	127	N/A	INTRINSIC
low complexity region	148	173	N/A	INTRINSIC
low complexity region	192	224	N/A	INTRINSIC
low complexity region	283	293	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135753

SMART Domains

Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620

Domain	Start	End	E-Value	Type
low complexity region	21	37	N/A	INTRINSIC
low complexity region	42	50	N/A	INTRINSIC
low complexity region	117	126	N/A	INTRINSIC
low complexity region	161	180	N/A	INTRINSIC
low complexity region	255	263	N/A	INTRINSIC
low complexity region	275	298	N/A	INTRINSIC
NIDO	389	546	8.33e-67	SMART
AMOP	545	657	1.29e-47	SMART
VWD	660	841	4.23e-26	SMART
EGF_like	1065	1097	3.23e1	SMART
EGF_like	1107	1143	3.5e1	SMART
low complexity region	1168	1182	N/A	INTRINSIC
EGF	1315	1352	1.4e0	SMART
transmembrane domain	1361	1383	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,514,602	W899R	probably damaging	Het
Abca5	A	T	11: 110,272,497	W1631R	possibly damaging	Het
Actg2	T	A	6: 83,527,368	D25V	probably damaging	Het
Akap10	G	C	11: 61,915,505	D132E	probably damaging	Het
Angptl2	G	T	2: 33,242,382	E334*	probably null	Het
Aprt	T	C	8: 122,574,935	R165G	probably benign	Het
B020004J07Rik	T	C	4: 101,837,141	I182V	possibly damaging	Het
Bmp1	A	G	14: 70,492,084	F549S	probably damaging	Het
Capzb	C	T	4: 139,280,553	T215I	probably benign	Het
Car14	C	T	3: 95,904,372	M1I	probably null	Het
Ccdc148	T	A	2: 58,823,636	Q501L	probably benign	Het
Ccdc32	G	A	2: 119,027,347	T12I	probably damaging	Het
Ccnf	G	A	17: 24,225,012	S594L	probably damaging	Het
Cdadc1	C	T	14: 59,573,834	C409Y	probably damaging	Het
Cdh23	G	T	10: 60,312,577	S2670R	probably damaging	Het
Cdh8	T	A	8: 99,279,674	K94*	probably null	Het
Cdhr2	A	T	13: 54,717,692	Y193F	probably damaging	Het
Cdon	T	A	9: 35,454,415	Y153*	probably null	Het
Chd1	G	A	17: 15,733,041	G413R	probably damaging	Het
Cit	A	T	5: 115,987,001	T1582S	probably benign	Het
Clec4a3	T	C	6: 122,964,340	L98P	probably benign	Het
Cpa4	T	A	6: 30,583,645	D253E	probably damaging	Het
Cyhr1	A	T	15: 76,658,547	Y138N	probably damaging	Het
Cyp2c40	T	A	19: 39,807,168	N189I	possibly damaging	Het
Daam2	G	T	17: 49,490,022	A245E	probably benign	Het
Dennd5b	A	G	6: 149,068,658	F121S	probably damaging	Het
Dgkd	A	G	1: 87,926,949	T658A	probably benign	Het
Dmwd	T	A	7: 19,080,340	L305Q	probably damaging	Het
Dnah5	A	T	15: 28,313,855	Y1939F	probably damaging	Het
Dock5	T	C	14: 67,821,327	T512A	probably damaging	Het
Dopey2	T	A	16: 93,755,514	D398E	probably benign	Het
Eef1akmt4	A	G	16: 20,618,529	H207R	probably damaging	Het
Egfr	T	C	11: 16,891,266	V719A	probably damaging	Het
Ep300	A	T	15: 81,586,583		probably benign	Het
Epha4	A	G	1: 77,390,031		probably null	Het
Erc2	T	G	14: 27,876,204		probably null	Het
Ergic1	A	T	17: 26,638,827	Y209F	possibly damaging	Het
Fbxw28	A	G	9: 109,326,633	I357T	probably damaging	Het
Flnb	A	T	14: 7,926,478	T1841S	probably benign	Het
Foxc1	G	A	13: 31,808,028	S274N	probably benign	Het
Fto	C	T	8: 91,409,443	T115M	probably damaging	Het
Gm10228	C	G	16: 89,041,299	C39S	unknown	Het
Gm7334	T	C	17: 50,698,715	F10L	possibly damaging	Het
Hfm1	A	G	5: 106,881,861	Y785H	probably damaging	Het
Hivep1	T	A	13: 42,159,461	S1726T	probably benign	Het
Htt	G	T	5: 34,852,190	C1505F	probably damaging	Het
Hydin	T	C	8: 110,505,843	S1665P	possibly damaging	Het
Ifi209	T	A	1: 173,642,879	N344K	probably damaging	Het
Ifnar2	T	C	16: 91,399,293	M262T	probably benign	Het
Ighv7-3	T	A	12: 114,153,207	S112C	probably damaging	Het
Igkv4-86	A	G	6: 68,910,579	S59P	probably benign	Het
Iglv1	A	G	16: 19,085,489		probably benign	Het
Ipo7	T	A	7: 110,052,799	D928E	possibly damaging	Het
Itgae	G	T	11: 73,123,269		probably null	Het
Kbtbd12	T	A	6: 88,618,197	Q217L	probably benign	Het
Kcnma1	T	A	14: 23,300,006	Y1155F	possibly damaging	Het
Kif14	A	G	1: 136,516,383	E1371G	probably benign	Het
Lilrb4a	A	T	10: 51,491,046	Y10F	probably benign	Het
Lrp2	A	T	2: 69,503,388	V1503E	probably damaging	Het
Mfsd6	A	T	1: 52,708,640	D355E	probably benign	Het
Mri1	T	C	8: 84,251,028	H226R		Het
Mroh4	C	T	15: 74,624,705	E278K	probably damaging	Het
Mzf1	A	T	7: 13,044,091	I541N	probably damaging	Het
Nasp	T	A	4: 116,612,033	E116D	probably benign	Het
Nlrp10	T	A	7: 108,925,826	E149V	probably damaging	Het
Notch4	G	A	17: 34,582,418	C1080Y	probably damaging	Het
Nova1	T	G	12: 46,720,698	I147L	unknown	Het
Ogdh	A	G	11: 6,338,558	M223V	probably benign	Het
Olfr1391	G	T	11: 49,327,671	A87S	probably benign	Het
Olfr444	T	C	6: 42,955,789	I97T	probably benign	Het
Olfr732	A	T	14: 50,281,488	I255N	probably damaging	Het
Olfr792	G	T	10: 129,541,455	R306L	probably benign	Het
P3h3	T	C	6: 124,854,432	Q330R	probably benign	Het
Pcdhb10	A	G	18: 37,411,882	T4A	not run	Het
Pkd2l2	A	T	18: 34,433,287		probably null	Het
Plekhb1	C	T	7: 100,645,663	V168I	probably benign	Het
Plxna4	C	T	6: 32,223,980	R753H	probably damaging	Het
Prex1	G	C	2: 166,713,709	P4A	unknown	Het
Ptgdr	A	G	14: 44,859,078	V59A	probably damaging	Het
Ralgapa1	T	A	12: 55,757,955	I519F	probably benign	Het
Rbpms	A	G	8: 33,789,453	I170T	probably benign	Het
Sec31b	T	A	19: 44,523,835		probably null	Het
Skint11	A	T	4: 114,227,708	Y138F	probably benign	Het
Slain2	A	G	5: 72,948,610	Y196C	probably damaging	Het
Slco1b2	T	A	6: 141,676,224	C503*	probably null	Het
Slfn3	A	T	11: 83,214,788	Y537F	possibly damaging	Het
Slu7	T	C	11: 43,444,765	Y443H	probably damaging	Het
Sorl1	T	A	9: 42,043,909	E683D	probably damaging	Het
Sos1	T	A	17: 80,413,713	I893L	probably benign	Het
St8sia2	T	A	7: 73,943,321	Y329F	probably damaging	Het
Stra6l	C	A	4: 45,869,570	S212*	probably null	Het
Syne3	C	T	12: 104,997,495		probably benign	Het
Tenm4	T	A	7: 96,895,692	I2342N	probably benign	Het
Tescl	T	A	7: 24,333,263	E212D	probably benign	Het
Trip11	A	G	12: 101,844,855	S1879P	probably benign	Het
Ube2c	A	T	2: 164,771,291		probably null	Het
Umodl1	T	A	17: 30,986,456	I675N	probably benign	Het
Vipr2	T	C	12: 116,122,718	F121S	probably damaging	Het
Vmn1r206	A	T	13: 22,620,669	S123T	possibly damaging	Het
Vmn1r58	A	G	7: 5,410,913	V106A	probably damaging	Het
Vmn2r112	A	G	17: 22,603,118	Y259C	probably damaging	Het
Vmn2r66	T	C	7: 85,005,701	K467E	probably benign	Het
Vmn2r98	T	C	17: 19,080,535	F600L	probably benign	Het
Vps13a	T	A	19: 16,746,000	N278I	possibly damaging	Het
Vwa5a	A	C	9: 38,741,162	D747A	possibly damaging	Het
Xdh	G	A	17: 73,934,834	P157S	possibly damaging	Het
Xrn1	G	A	9: 95,998,348		probably null	Het
Zfp362	T	A	4: 128,787,031	H180L	probably benign	Het
Zfp560	A	T	9: 20,347,323	W748R	possibly damaging	Het
Zfp808	A	T	13: 62,172,664	Q569L	probably benign	Het
Zfp93	T	A	7: 24,275,218	D209E	possibly damaging	Het

Other mutations in Muc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00088:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00089:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00090:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00091:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00092:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00163:Muc4	APN	16	32754090	missense	probably benign	0.20
IGL00324:Muc4	APN	16	32778812	missense	probably benign	0.03
IGL00331:Muc4	APN	16	32753185	missense	probably benign	0.01
IGL00539:Muc4	APN	16	32750910	missense	possibly damaging	0.53
IGL00590:Muc4	APN	16	32754347	missense	probably benign	0.10
IGL00990:Muc4	APN	16	32753955	missense	possibly damaging	0.86
IGL00990:Muc4	APN	16	32755805	unclassified	probably benign
IGL00990:Muc4	APN	16	32753823	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753848	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753849	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753863	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753886	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32752569	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32754071	missense	probably benign	0.01
IGL01091:Muc4	APN	16	32753927	missense	probably benign	0.04
IGL01124:Muc4	APN	16	32768730	missense	possibly damaging	0.65
IGL01131:Muc4	APN	16	32753901	missense	possibly damaging	0.72
IGL01536:Muc4	APN	16	32763966	missense	possibly damaging	0.93
IGL01603:Muc4	APN	16	32750655	missense	probably benign	0.23
IGL01618:Muc4	APN	16	32756627	missense	unknown
IGL01625:Muc4	APN	16	32755544	unclassified	probably benign
IGL01626:Muc4	APN	16	32736402	missense	possibly damaging	0.48
IGL01653:Muc4	APN	16	32761348	splice site	probably null
IGL01682:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL01870:Muc4	APN	16	32753196	missense	probably benign	0.01
IGL01966:Muc4	APN	16	32751426	missense	possibly damaging	0.84
IGL01973:Muc4	APN	16	32754265	missense	probably benign	0.01
IGL02089:Muc4	APN	16	32751313	missense	possibly damaging	0.83
IGL02152:Muc4	APN	16	32777649	splice site	probably benign
IGL02210:Muc4	APN	16	32752254	missense	probably benign	0.00
IGL02278:Muc4	APN	16	32754529	missense	probably benign	0.01
IGL02280:Muc4	APN	16	32754529	missense	probably benign	0.01
IGL02316:Muc4	APN	16	32750850	missense	possibly damaging	0.73
IGL02351:Muc4	APN	16	32750986	missense	possibly damaging	0.86
IGL02358:Muc4	APN	16	32750986	missense	possibly damaging	0.86
IGL02391:Muc4	APN	16	32752076	missense	probably benign	0.41
IGL02449:Muc4	APN	16	32756129	unclassified	probably benign
IGL02607:Muc4	APN	16	32775819	missense	possibly damaging	0.73
IGL02888:Muc4	APN	16	32755282	unclassified	probably benign
IGL02893:Muc4	APN	16	32751648	missense	possibly damaging	0.68
IGL02902:Muc4	APN	16	32750394	missense	possibly damaging	0.50
IGL03007:Muc4	APN	16	32752048	missense	possibly damaging	0.84
IGL03161:Muc4	APN	16	32751948	missense	possibly damaging	0.84
IGL03304:Muc4	APN	16	32751439	nonsense	probably null
IGL03335:Muc4	APN	16	32753021	missense	probably benign	0.01
IGL03411:Muc4	APN	16	32754318	missense	probably benign	0.01
multisplendored	UTSW	16	32751051	missense	possibly damaging	0.53
protean	UTSW	16	32754689	missense	probably benign	0.00
R0864_muc4_269	UTSW	16	32752002	missense	probably benign	0.01
3-1:Muc4	UTSW	16	32760251	splice site	probably benign
3-1:Muc4	UTSW	16	32770394	missense	possibly damaging	0.86
BB004:Muc4	UTSW	16	32771637	missense
BB014:Muc4	UTSW	16	32771637	missense
IGL02835:Muc4	UTSW	16	32763945	missense	probably benign	0.32
P0035:Muc4	UTSW	16	32760248	splice site	probably benign
PIT4131001:Muc4	UTSW	16	32755676	unclassified	probably benign
PIT4131001:Muc4	UTSW	16	32755684	unclassified	probably benign
PIT4131001:Muc4	UTSW	16	32755699	unclassified	probably benign
PIT4142001:Muc4	UTSW	16	32754529	missense	probably benign	0.01
PIT4142001:Muc4	UTSW	16	32755676	unclassified	probably benign
PIT4142001:Muc4	UTSW	16	32755684	unclassified	probably benign
PIT4366001:Muc4	UTSW	16	32754796	missense	unknown
PIT4531001:Muc4	UTSW	16	32756017	missense	unknown
R0119:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0133:Muc4	UTSW	16	32771604	missense	possibly damaging	0.91
R0136:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0243:Muc4	UTSW	16	32765746	missense	possibly damaging	0.53
R0277:Muc4	UTSW	16	32755690	unclassified	probably benign
R0299:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0380:Muc4	UTSW	16	32752905	missense	probably benign	0.00
R0462:Muc4	UTSW	16	32762536	missense	possibly damaging	0.93
R0507:Muc4	UTSW	16	32751069	missense	probably benign	0.01
R0508:Muc4	UTSW	16	32751313	missense	possibly damaging	0.83
R0543:Muc4	UTSW	16	32756746	missense	unknown
R0578:Muc4	UTSW	16	32755690	unclassified	probably benign
R0617:Muc4	UTSW	16	32752107	missense	possibly damaging	0.83
R0656:Muc4	UTSW	16	32751670	missense	possibly damaging	0.91
R0726:Muc4	UTSW	16	32769827	missense	probably damaging	0.99
R0727:Muc4	UTSW	16	32769847	missense	probably benign	0.01
R0776:Muc4	UTSW	16	32752220	missense	probably benign	0.04
R0854:Muc4	UTSW	16	32778955	missense	possibly damaging	0.53
R0862:Muc4	UTSW	16	32752002	missense	probably benign	0.01
R0864:Muc4	UTSW	16	32752002	missense	probably benign	0.01
R0926:Muc4	UTSW	16	32756196	unclassified	probably benign
R0990:Muc4	UTSW	16	32752722	missense	probably benign	0.00
R1127:Muc4	UTSW	16	32750525	missense	possibly damaging	0.92
R1203:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R1433:Muc4	UTSW	16	32753020	missense	probably benign	0.00
R1466:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1466:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1506:Muc4	UTSW	16	32752233	missense	possibly damaging	0.59
R1518:Muc4	UTSW	16	32750349	missense	possibly damaging	0.84
R1544:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1584:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1593:Muc4	UTSW	16	32754686	missense	probably benign	0.00
R1601:Muc4	UTSW	16	32755501	unclassified	probably benign
R1611:Muc4	UTSW	16	32750986	missense	possibly damaging	0.86
R1673:Muc4	UTSW	16	32756902	missense	probably benign	0.11
R1717:Muc4	UTSW	16	32753405	missense	possibly damaging	0.53
R1822:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1824:Muc4	UTSW	16	32755933	unclassified	probably benign
R1839:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1846:Muc4	UTSW	16	32752369	missense	probably benign	0.01
R1864:Muc4	UTSW	16	32756251	unclassified	probably benign
R1868:Muc4	UTSW	16	32756341	missense	unknown
R1928:Muc4	UTSW	16	32750532	missense	probably damaging	0.99
R1942:Muc4	UTSW	16	32750642	missense	probably damaging	0.99
R2017:Muc4	UTSW	16	32751303	missense	possibly damaging	0.92
R2023:Muc4	UTSW	16	32752254	missense	probably benign	0.00
R2081:Muc4	UTSW	16	32752220	missense	probably benign	0.04
R2088:Muc4	UTSW	16	32756409	missense	unknown
R2121:Muc4	UTSW	16	32760238	missense	unknown
R2139:Muc4	UTSW	16	32761225	missense	unknown
R2158:Muc4	UTSW	16	32754563	missense	probably benign	0.10
R2165:Muc4	UTSW	16	32750476	missense	probably damaging	0.96
R2210:Muc4	UTSW	16	32755176	frame shift	probably null
R2225:Muc4	UTSW	16	32755891	unclassified	probably benign
R2225:Muc4	UTSW	16	32766942	missense	possibly damaging	0.73
R2269:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R2679:Muc4	UTSW	16	32757472	missense	unknown
R3703:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R3816:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R3909:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4014:Muc4	UTSW	16	32755273	unclassified	probably benign
R4065:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4066:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4067:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4245:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4249:Muc4	UTSW	16	32755826	unclassified	probably benign
R4344:Muc4	UTSW	16	32770292	missense	possibly damaging	0.53
R4388:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4393:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R4482:Muc4	UTSW	16	32756701	missense	unknown
R4523:Muc4	UTSW	16	32736336	utr 5 prime	probably benign
R4527:Muc4	UTSW	16	32755843	unclassified	probably benign
R4572:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4587:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4614:Muc4	UTSW	16	32757058	missense	probably benign	0.03
R4635:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4661:Muc4	UTSW	16	32769277	missense	possibly damaging	0.71
R4701:Muc4	UTSW	16	32755846	unclassified	probably benign
R4730:Muc4	UTSW	16	32751214	missense	possibly damaging	0.86
R4740:Muc4	UTSW	16	32775903	missense	possibly damaging	0.91
R4762:Muc4	UTSW	16	32753625	unclassified	probably benign
R4818:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4821:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4825:Muc4	UTSW	16	32751747	missense	probably benign	0.41
R4830:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4860:Muc4	UTSW	16	32754616	missense	probably benign	0.35
R4860:Muc4	UTSW	16	32754625	missense	probably benign	0.18
R4869:Muc4	UTSW	16	32754836	unclassified	probably benign
R4934:Muc4	UTSW	16	32756098	unclassified	probably benign
R4959:Muc4	UTSW	16	32754319	missense	possibly damaging	0.73
R4969:Muc4	UTSW	16	32754572	missense	probably benign	0.01
R4995:Muc4	UTSW	16	32754214	missense	probably benign	0.01
R4995:Muc4	UTSW	16	32754041	missense	probably benign	0.01
R4999:Muc4	UTSW	16	32756296	unclassified	probably benign
R5073:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R5075:Muc4	UTSW	16	32754794	unclassified	probably benign
R5152:Muc4	UTSW	16	32757058	nonsense	probably null
R5161:Muc4	UTSW	16	32762521	missense	probably damaging	0.98
R5174:Muc4	UTSW	16	32751738	missense	possibly damaging	0.84
R5268:Muc4	UTSW	16	32751666	missense	possibly damaging	0.83
R5447:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R5474:Muc4	UTSW	16	32761261	missense	unknown
R5567:Muc4	UTSW	16	32777692	missense	possibly damaging	0.72
R5570:Muc4	UTSW	16	32777692	missense	possibly damaging	0.72
R5618:Muc4	UTSW	16	32754253	missense	probably benign	0.01
R5665:Muc4	UTSW	16	32750782	missense	probably benign	0.33
R5667:Muc4	UTSW	16	32753720	missense	probably benign	0.01
R5671:Muc4	UTSW	16	32753720	missense	probably benign	0.01
R5693:Muc4	UTSW	16	32776807	missense	possibly damaging	0.53
R5703:Muc4	UTSW	16	32736241	nonsense	probably null
R5708:Muc4	UTSW	16	32754769	unclassified	probably benign
R5715:Muc4	UTSW	16	32751916	missense	possibly damaging	0.92
R5849:Muc4	UTSW	16	32774839	missense	possibly damaging	0.53
R5873:Muc4	UTSW	16	32751295	missense	possibly damaging	0.61
R5930:Muc4	UTSW	16	32751705	missense	probably benign	0.41
R5933:Muc4	UTSW	16	32753052	missense	probably benign	0.01
R5966:Muc4	UTSW	16	32756278	unclassified	probably benign
R6062:Muc4	UTSW	16	32759308	missense	unknown
R6067:Muc4	UTSW	16	32755247	unclassified	probably benign
R6067:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R6078:Muc4	UTSW	16	32755247	unclassified	probably benign
R6079:Muc4	UTSW	16	32755247	unclassified	probably benign
R6112:Muc4	UTSW	16	32775783	missense	possibly damaging	0.86
R6120:Muc4	UTSW	16	32756795	missense	unknown
R6144:Muc4	UTSW	16	32766924	missense	possibly damaging	0.53
R6148:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R6173:Muc4	UTSW	16	32736140	start gained	probably benign
R6268:Muc4	UTSW	16	32768767	missense	probably damaging	0.99
R6299:Muc4	UTSW	16	32752035	missense	possibly damaging	0.48
R6307:Muc4	UTSW	16	32753946	missense	possibly damaging	0.56
R6354:Muc4	UTSW	16	32754358	missense	probably benign	0.19
R6361:Muc4	UTSW	16	32767351	missense	probably benign	0.32
R6375:Muc4	UTSW	16	32736243	utr 5 prime	probably benign
R6378:Muc4	UTSW	16	32778946	missense	probably benign	0.33
R6418:Muc4	UTSW	16	32751789	missense	possibly damaging	0.68
R6458:Muc4	UTSW	16	32759320	critical splice donor site	probably null
R6527:Muc4	UTSW	16	32753433	missense	probably benign	0.01
R6616:Muc4	UTSW	16	32782008	missense	possibly damaging	0.93
R6636:Muc4	UTSW	16	32753964	missense	probably benign	0.01
R6637:Muc4	UTSW	16	32753964	missense	probably benign	0.01
R6915:Muc4	UTSW	16	32766938	missense	probably benign	0.18
R6947:Muc4	UTSW	16	32775803	missense	possibly damaging	0.91
R6976:Muc4	UTSW	16	32762518	missense	possibly damaging	0.92
R6985:Muc4	UTSW	16	32751999	missense	probably benign	0.00
R7020:Muc4	UTSW	16	32751810	nonsense	probably null
R7033:Muc4	UTSW	16	32756324	unclassified	probably benign
R7098:Muc4	UTSW	16	32757091	missense
R7123:Muc4	UTSW	16	32750691	missense	possibly damaging	0.83
R7173:Muc4	UTSW	16	32762488	missense	probably damaging	0.97
R7178:Muc4	UTSW	16	32752788	missense	unknown
R7294:Muc4	UTSW	16	32756461	missense	possibly damaging	0.53
R7318:Muc4	UTSW	16	32755336	missense	unknown
R7361:Muc4	UTSW	16	32754670	missense	probably benign	0.18
R7380:Muc4	UTSW	16	32755366	missense	unknown
R7381:Muc4	UTSW	16	32780915	missense
R7411:Muc4	UTSW	16	32751322	missense	probably benign	0.12
R7422:Muc4	UTSW	16	32754689	missense	probably benign	0.00
R7482:Muc4	UTSW	16	32766950	missense
R7539:Muc4	UTSW	16	32756396	missense
R7544:Muc4	UTSW	16	32736198	start codon destroyed	probably null
R7574:Muc4	UTSW	16	32753411	missense	probably benign	0.18
R7576:Muc4	UTSW	16	32754500	missense	probably benign	0.10
R7585:Muc4	UTSW	16	32765702	missense
R7596:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7597:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7602:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7616:Muc4	UTSW	16	32752361	nonsense	probably null
R7639:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7640:Muc4	UTSW	16	32760105	missense
R7651:Muc4	UTSW	16	32756575	missense
R7688:Muc4	UTSW	16	32751460	missense	possibly damaging	0.68
R7689:Muc4	UTSW	16	32753011	missense	probably benign	0.10
R7752:Muc4	UTSW	16	32768734	missense
R7768:Muc4	UTSW	16	32756194	missense	unknown
R7787:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7789:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7838:Muc4	UTSW	16	32752558	nonsense	probably null
R7871:Muc4	UTSW	16	32754935	missense	unknown
R7921:Muc4	UTSW	16	32751321	missense	possibly damaging	0.68
R7927:Muc4	UTSW	16	32771637	missense
R7930:Muc4	UTSW	16	32754078	unclassified	probably benign
R8000:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R8062:Muc4	UTSW	16	32756749	missense
R8096:Muc4	UTSW	16	32755390	missense	unknown
R8115:Muc4	UTSW	16	32755304	missense	unknown
R8162:Muc4	UTSW	16	32750379	missense	unknown
R8220:Muc4	UTSW	16	32755327	missense	unknown
R8260:Muc4	UTSW	16	32754076	unclassified	probably benign
R8290:Muc4	UTSW	16	32754316	missense	probably benign	0.01
R8299:Muc4	UTSW	16	32755897	missense	unknown
R8313:Muc4	UTSW	16	32753423	missense	probably benign	0.04
R8356:Muc4	UTSW	16	32754076	unclassified	probably benign
R8463:Muc4	UTSW	16	32752401	missense	probably benign	0.00
R8479:Muc4	UTSW	16	32753508	missense	possibly damaging	0.59
R8480:Muc4	UTSW	16	32752993	missense	probably benign	0.20
R8510:Muc4	UTSW	16	32754076	unclassified	probably benign
R8515:Muc4	UTSW	16	32755255	missense	unknown
R8559:Muc4	UTSW	16	32754715	missense	unknown
R8685:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R8687:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R8728:Muc4	UTSW	16	32754952	missense	unknown
R8754:Muc4	UTSW	16	32781986	missense
R8845:Muc4	UTSW	16	32756515	missense	possibly damaging	0.86
R8852:Muc4	UTSW	16	32750643	missense	possibly damaging	0.66
R8863:Muc4	UTSW	16	32751462	missense	possibly damaging	0.84
R8896:Muc4	UTSW	16	32754673	missense	probably benign	0.01
R8929:Muc4	UTSW	16	32753994	missense	probably benign	0.00
R8929:Muc4	UTSW	16	32754017	missense	possibly damaging	0.53
R8990:Muc4	UTSW	16	32752209	missense	probably benign	0.01
R9018:Muc4	UTSW	16	32762536	missense
R9034:Muc4	UTSW	16	32754076	unclassified	probably benign
R9064:Muc4	UTSW	16	32754397	missense	possibly damaging	0.53
R9068:Muc4	UTSW	16	32754076	unclassified	probably benign
R9086:Muc4	UTSW	16	32757468	missense
R9151:Muc4	UTSW	16	32752617	missense	probably benign	0.01
R9187:Muc4	UTSW	16	32768728	missense
R9336:Muc4	UTSW	16	32750938	missense	possibly damaging	0.86
R9343:Muc4	UTSW	16	32751153	missense	possibly damaging	0.53
R9363:Muc4	UTSW	16	32756618	missense
R9429:Muc4	UTSW	16	32755724	missense	unknown
R9570:Muc4	UTSW	16	32750877	missense	possibly damaging	0.53
R9609:Muc4	UTSW	16	32756860	missense
R9696:Muc4	UTSW	16	32753284	missense	probably benign	0.00
R9709:Muc4	UTSW	16	32770270	missense
R9743:Muc4	UTSW	16	32780824	missense
R9747:Muc4	UTSW	16	32754698	missense	probably benign	0.01
RF014:Muc4	UTSW	16	32751858	missense	probably damaging	0.98
U15987:Muc4	UTSW	16	32754529	missense	probably benign	0.01
U15987:Muc4	UTSW	16	32755247	unclassified	probably benign
V5622:Muc4	UTSW	16	32751825	missense	probably benign	0.00
X0018:Muc4	UTSW	16	32755481	unclassified	probably benign
X0028:Muc4	UTSW	16	32759319	critical splice donor site	probably null
Z1088:Muc4	UTSW	16	32756076	unclassified	probably benign
Z1176:Muc4	UTSW	16	32768730	missense	possibly damaging	0.65
Z1177:Muc4	UTSW	16	32767393	nonsense	probably null
Z1177:Muc4	UTSW	16	32767394	missense
Z1177:Muc4	UTSW	16	32774862	missense

Predicted Primers

PCR Primer
(F):5'- TCCCATCATGAGCAGCTCAG -3'
(R):5'- CATCACTGGCGTTGTGGTAG -3'

Sequencing Primer
(F):5'- GCAGCTCAGCTCCAAGTAC -3'
(R):5'- AGGATTGCTGCTGGTCCC -3'

Posted On

2019-11-26