Mutagenetix > Incidental Mutation

Incidental Mutation 'R7763:Ccnf'

598086

Institutional Source

Beutler Lab

Gene Symbol

Ccnf

Ensembl Gene

ENSMUSG00000072082

Gene Name

cyclin F

Synonyms

Fbxo1, CycF

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24223232-24251409 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24225012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 594 (S594L)

Ref Sequence

ENSEMBL: ENSMUSP00000111048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024930] [ENSMUST00000115390]

AlphaFold

P51944

Predicted Effect

probably benign
Transcript: ENSMUST00000024930

SMART Domains

Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118

Domain	Start	End	E-Value	Type
low complexity region	32	49	N/A	INTRINSIC
low complexity region	78	84	N/A	INTRINSIC
low complexity region	111	131	N/A	INTRINSIC
Pfam:DUF4693	150	434	8.6e-145	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115390
AA Change: S594L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: S594L

Domain	Start	End	E-Value	Type
FBOX	35	75	1.56e-6	SMART
CYCLIN	315	399	2.25e-13	SMART
Cyclin_C	408	531	2.58e-19	SMART
CYCLIN	416	494	2.27e-9	SMART
low complexity region	545	555	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	695	708	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124557

SMART Domains

Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

Domain	Start	End	E-Value	Type
low complexity region	16	32	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137648

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148704

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149916

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171563

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,514,602	W899R	probably damaging	Het
Abca5	A	T	11: 110,272,497	W1631R	possibly damaging	Het
Actg2	T	A	6: 83,527,368	D25V	probably damaging	Het
Akap10	G	C	11: 61,915,505	D132E	probably damaging	Het
Angptl2	G	T	2: 33,242,382	E334*	probably null	Het
Aprt	T	C	8: 122,574,935	R165G	probably benign	Het
B020004J07Rik	T	C	4: 101,837,141	I182V	possibly damaging	Het
Bmp1	A	G	14: 70,492,084	F549S	probably damaging	Het
Capzb	C	T	4: 139,280,553	T215I	probably benign	Het
Car14	C	T	3: 95,904,372	M1I	probably null	Het
Ccdc148	T	A	2: 58,823,636	Q501L	probably benign	Het
Ccdc32	G	A	2: 119,027,347	T12I	probably damaging	Het
Cdadc1	C	T	14: 59,573,834	C409Y	probably damaging	Het
Cdh23	G	T	10: 60,312,577	S2670R	probably damaging	Het
Cdh8	T	A	8: 99,279,674	K94*	probably null	Het
Cdhr2	A	T	13: 54,717,692	Y193F	probably damaging	Het
Cdon	T	A	9: 35,454,415	Y153*	probably null	Het
Chd1	G	A	17: 15,733,041	G413R	probably damaging	Het
Cit	A	T	5: 115,987,001	T1582S	probably benign	Het
Clec4a3	T	C	6: 122,964,340	L98P	probably benign	Het
Cpa4	T	A	6: 30,583,645	D253E	probably damaging	Het
Cyhr1	A	T	15: 76,658,547	Y138N	probably damaging	Het
Cyp2c40	T	A	19: 39,807,168	N189I	possibly damaging	Het
Daam2	G	T	17: 49,490,022	A245E	probably benign	Het
Dennd5b	A	G	6: 149,068,658	F121S	probably damaging	Het
Dgkd	A	G	1: 87,926,949	T658A	probably benign	Het
Dmwd	T	A	7: 19,080,340	L305Q	probably damaging	Het
Dnah5	A	T	15: 28,313,855	Y1939F	probably damaging	Het
Dock5	T	C	14: 67,821,327	T512A	probably damaging	Het
Dopey2	T	A	16: 93,755,514	D398E	probably benign	Het
Eef1akmt4	A	G	16: 20,618,529	H207R	probably damaging	Het
Egfr	T	C	11: 16,891,266	V719A	probably damaging	Het
Ep300	A	T	15: 81,586,583		probably benign	Het
Epha4	A	G	1: 77,390,031		probably null	Het
Erc2	T	G	14: 27,876,204		probably null	Het
Ergic1	A	T	17: 26,638,827	Y209F	possibly damaging	Het
Fbxw28	A	G	9: 109,326,633	I357T	probably damaging	Het
Flnb	A	T	14: 7,926,478	T1841S	probably benign	Het
Foxc1	G	A	13: 31,808,028	S274N	probably benign	Het
Fto	C	T	8: 91,409,443	T115M	probably damaging	Het
Gm10228	C	G	16: 89,041,299	C39S	unknown	Het
Gm7334	T	C	17: 50,698,715	F10L	possibly damaging	Het
Hfm1	A	G	5: 106,881,861	Y785H	probably damaging	Het
Hivep1	T	A	13: 42,159,461	S1726T	probably benign	Het
Htt	G	T	5: 34,852,190	C1505F	probably damaging	Het
Hydin	T	C	8: 110,505,843	S1665P	possibly damaging	Het
Ifi209	T	A	1: 173,642,879	N344K	probably damaging	Het
Ifnar2	T	C	16: 91,399,293	M262T	probably benign	Het
Ighv7-3	T	A	12: 114,153,207	S112C	probably damaging	Het
Igkv4-86	A	G	6: 68,910,579	S59P	probably benign	Het
Iglv1	A	G	16: 19,085,489		probably benign	Het
Ipo7	T	A	7: 110,052,799	D928E	possibly damaging	Het
Itgae	G	T	11: 73,123,269		probably null	Het
Kbtbd12	T	A	6: 88,618,197	Q217L	probably benign	Het
Kcnma1	T	A	14: 23,300,006	Y1155F	possibly damaging	Het
Kif14	A	G	1: 136,516,383	E1371G	probably benign	Het
Lilrb4a	A	T	10: 51,491,046	Y10F	probably benign	Het
Lrp2	A	T	2: 69,503,388	V1503E	probably damaging	Het
Mfsd6	A	T	1: 52,708,640	D355E	probably benign	Het
Mri1	T	C	8: 84,251,028	H226R		Het
Mroh4	C	T	15: 74,624,705	E278K	probably damaging	Het
Muc4	T	A	16: 32,753,311	L1063H	probably benign	Het
Mzf1	A	T	7: 13,044,091	I541N	probably damaging	Het
Nasp	T	A	4: 116,612,033	E116D	probably benign	Het
Nlrp10	T	A	7: 108,925,826	E149V	probably damaging	Het
Notch4	G	A	17: 34,582,418	C1080Y	probably damaging	Het
Nova1	T	G	12: 46,720,698	I147L	unknown	Het
Ogdh	A	G	11: 6,338,558	M223V	probably benign	Het
Olfr1391	G	T	11: 49,327,671	A87S	probably benign	Het
Olfr444	T	C	6: 42,955,789	I97T	probably benign	Het
Olfr732	A	T	14: 50,281,488	I255N	probably damaging	Het
Olfr792	G	T	10: 129,541,455	R306L	probably benign	Het
P3h3	T	C	6: 124,854,432	Q330R	probably benign	Het
Pcdhb10	A	G	18: 37,411,882	T4A	not run	Het
Pkd2l2	A	T	18: 34,433,287		probably null	Het
Plekhb1	C	T	7: 100,645,663	V168I	probably benign	Het
Plxna4	C	T	6: 32,223,980	R753H	probably damaging	Het
Prex1	G	C	2: 166,713,709	P4A	unknown	Het
Ptgdr	A	G	14: 44,859,078	V59A	probably damaging	Het
Ralgapa1	T	A	12: 55,757,955	I519F	probably benign	Het
Rbpms	A	G	8: 33,789,453	I170T	probably benign	Het
Sec31b	T	A	19: 44,523,835		probably null	Het
Skint11	A	T	4: 114,227,708	Y138F	probably benign	Het
Slain2	A	G	5: 72,948,610	Y196C	probably damaging	Het
Slco1b2	T	A	6: 141,676,224	C503*	probably null	Het
Slfn3	A	T	11: 83,214,788	Y537F	possibly damaging	Het
Slu7	T	C	11: 43,444,765	Y443H	probably damaging	Het
Sorl1	T	A	9: 42,043,909	E683D	probably damaging	Het
Sos1	T	A	17: 80,413,713	I893L	probably benign	Het
St8sia2	T	A	7: 73,943,321	Y329F	probably damaging	Het
Stra6l	C	A	4: 45,869,570	S212*	probably null	Het
Syne3	C	T	12: 104,997,495		probably benign	Het
Tenm4	T	A	7: 96,895,692	I2342N	probably benign	Het
Tescl	T	A	7: 24,333,263	E212D	probably benign	Het
Trip11	A	G	12: 101,844,855	S1879P	probably benign	Het
Ube2c	A	T	2: 164,771,291		probably null	Het
Umodl1	T	A	17: 30,986,456	I675N	probably benign	Het
Vipr2	T	C	12: 116,122,718	F121S	probably damaging	Het
Vmn1r206	A	T	13: 22,620,669	S123T	possibly damaging	Het
Vmn1r58	A	G	7: 5,410,913	V106A	probably damaging	Het
Vmn2r112	A	G	17: 22,603,118	Y259C	probably damaging	Het
Vmn2r66	T	C	7: 85,005,701	K467E	probably benign	Het
Vmn2r98	T	C	17: 19,080,535	F600L	probably benign	Het
Vps13a	T	A	19: 16,746,000	N278I	possibly damaging	Het
Vwa5a	A	C	9: 38,741,162	D747A	possibly damaging	Het
Xdh	G	A	17: 73,934,834	P157S	possibly damaging	Het
Xrn1	G	A	9: 95,998,348		probably null	Het
Zfp362	T	A	4: 128,787,031	H180L	probably benign	Het
Zfp560	A	T	9: 20,347,323	W748R	possibly damaging	Het
Zfp808	A	T	13: 62,172,664	Q569L	probably benign	Het
Zfp93	T	A	7: 24,275,218	D209E	possibly damaging	Het

Other mutations in Ccnf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Ccnf	APN	17	24225012	missense	probably damaging	1.00
IGL01942:Ccnf	APN	17	24242320	missense	probably benign	0.03
IGL02251:Ccnf	APN	17	24226539	missense	probably benign	0.00
IGL02945:Ccnf	APN	17	24224916	missense	probably damaging	0.99
IGL02952:Ccnf	APN	17	24231325	missense	possibly damaging	0.93
albuquerque	UTSW	17	24223997	nonsense	probably null
R0326:Ccnf	UTSW	17	24231810	missense	possibly damaging	0.84
R0891:Ccnf	UTSW	17	24226777	missense	possibly damaging	0.93
R1069:Ccnf	UTSW	17	24223997	nonsense	probably null
R1072:Ccnf	UTSW	17	24237162	missense	probably damaging	0.97
R1693:Ccnf	UTSW	17	24226540	frame shift	probably null
R2147:Ccnf	UTSW	17	24230314	critical splice donor site	probably null
R3929:Ccnf	UTSW	17	24234382	missense	probably damaging	1.00
R4081:Ccnf	UTSW	17	24223898	makesense	probably null
R4260:Ccnf	UTSW	17	24226767	missense	probably damaging	1.00
R4579:Ccnf	UTSW	17	24231329	nonsense	probably null
R4651:Ccnf	UTSW	17	24231786	missense	probably damaging	1.00
R4844:Ccnf	UTSW	17	24230357	nonsense	probably null
R4876:Ccnf	UTSW	17	24230337	missense	probably damaging	1.00
R5234:Ccnf	UTSW	17	24234437	nonsense	probably null
R5352:Ccnf	UTSW	17	24243273	splice site	probably null
R5845:Ccnf	UTSW	17	24240793	missense	possibly damaging	0.95
R6084:Ccnf	UTSW	17	24231837	missense	probably damaging	1.00
R6219:Ccnf	UTSW	17	24226704	nonsense	probably null
R7021:Ccnf	UTSW	17	24242231	missense	probably damaging	1.00
R7176:Ccnf	UTSW	17	24249402	missense	possibly damaging	0.54
R7180:Ccnf	UTSW	17	24223915	missense	probably benign	0.00
R7485:Ccnf	UTSW	17	24249258	missense	probably damaging	0.97
R8016:Ccnf	UTSW	17	24231810	missense	possibly damaging	0.84
R8034:Ccnf	UTSW	17	24231831	missense	probably damaging	1.00
R8069:Ccnf	UTSW	17	24225015	missense	probably damaging	1.00
R9021:Ccnf	UTSW	17	24226705	nonsense	probably null
R9623:Ccnf	UTSW	17	24249393	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCAGTACAGTGCCAGATG -3'
(R):5'- ACATCTGCCCTAGCTTCATG -3'

Sequencing Primer
(F):5'- AGATGGCCCTCAGATCATGTGTC -3'
(R):5'- TTTTCTAGAACACACGGTGAGAGCC -3'

Posted On

2019-11-26