Incidental Mutation 'R7763:Sos1'
ID 598093
Institutional Source Beutler Lab
Gene Symbol Sos1
Ensembl Gene ENSMUSG00000024241
Gene Name SOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms 4430401P03Rik
MMRRC Submission 045819-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80701181-80787882 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80721142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 893 (I893L)
Ref Sequence ENSEMBL: ENSMUSP00000067786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068714]
AlphaFold Q62245
PDB Structure CRK SH3 DOMAIN COMPLEXED WITH PEPTOID INHIBITOR [X-RAY DIFFRACTION]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
PLECKSTRIN HOMOLOGY DOMAIN OF SON OF SEVENLESS 1 (SOS1) WITH GLYCINE-SERINE ADDED TO THE N-TERMINUS, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000068714
AA Change: I893L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067786
Gene: ENSMUSG00000024241
AA Change: I893L

DomainStartEndE-ValueType
Pfam:Histone 40 169 6.8e-16 PFAM
RhoGEF 204 389 8.5e-35 SMART
PH 444 548 2.44e-17 SMART
RasGEFN 596 741 2.18e-56 SMART
RasGEF 776 1020 4.44e-102 SMART
low complexity region 1079 1093 N/A INTRINSIC
low complexity region 1116 1127 N/A INTRINSIC
low complexity region 1132 1154 N/A INTRINSIC
Blast:RasGEF 1155 1306 1e-51 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. The product of this gene may regulate RAS proteins by facilitating the exchange of GTP for GDP. Mutations in this gene are associated with gingival fibromatosis 1 and Noonan syndrome type 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant embryos exhibit placental and cardiovascular defects resulting in death around mid-gestation. When heterozygous, these mutations enhance the eye defects of homozygous mutants of the epidermal growth factor receptor gene. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(21)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,113,825 (GRCm39) W899R probably damaging Het
Abca5 A T 11: 110,163,323 (GRCm39) W1631R possibly damaging Het
Actg2 T A 6: 83,504,350 (GRCm39) D25V probably damaging Het
Akap10 G C 11: 61,806,331 (GRCm39) D132E probably damaging Het
Angptl2 G T 2: 33,132,394 (GRCm39) E334* probably null Het
Aprt T C 8: 123,301,674 (GRCm39) R165G probably benign Het
Bmp1 A G 14: 70,729,524 (GRCm39) F549S probably damaging Het
Capzb C T 4: 139,007,864 (GRCm39) T215I probably benign Het
Car14 C T 3: 95,811,684 (GRCm39) M1I probably null Het
Ccdc148 T A 2: 58,713,648 (GRCm39) Q501L probably benign Het
Ccdc32 G A 2: 118,857,828 (GRCm39) T12I probably damaging Het
Ccnf G A 17: 24,443,986 (GRCm39) S594L probably damaging Het
Cdadc1 C T 14: 59,811,283 (GRCm39) C409Y probably damaging Het
Cdh23 G T 10: 60,148,356 (GRCm39) S2670R probably damaging Het
Cdh8 T A 8: 100,006,306 (GRCm39) K94* probably null Het
Cdhr2 A T 13: 54,865,505 (GRCm39) Y193F probably damaging Het
Cdon T A 9: 35,365,711 (GRCm39) Y153* probably null Het
Chd1 G A 17: 15,953,303 (GRCm39) G413R probably damaging Het
Cit A T 5: 116,125,060 (GRCm39) T1582S probably benign Het
Clec4a3 T C 6: 122,941,299 (GRCm39) L98P probably benign Het
Cpa4 T A 6: 30,583,644 (GRCm39) D253E probably damaging Het
Cyp2c40 T A 19: 39,795,612 (GRCm39) N189I possibly damaging Het
Daam2 G T 17: 49,797,050 (GRCm39) A245E probably benign Het
Dennd5b A G 6: 148,970,156 (GRCm39) F121S probably damaging Het
Dgkd A G 1: 87,854,671 (GRCm39) T658A probably benign Het
Dmwd T A 7: 18,814,265 (GRCm39) L305Q probably damaging Het
Dnah5 A T 15: 28,314,001 (GRCm39) Y1939F probably damaging Het
Dock5 T C 14: 68,058,776 (GRCm39) T512A probably damaging Het
Dop1b T A 16: 93,552,402 (GRCm39) D398E probably benign Het
Eef1akmt4 A G 16: 20,437,279 (GRCm39) H207R probably damaging Het
Egfr T C 11: 16,841,266 (GRCm39) V719A probably damaging Het
Ep300 A T 15: 81,470,784 (GRCm39) probably benign Het
Epha4 A G 1: 77,366,668 (GRCm39) probably null Het
Erc2 T G 14: 27,598,161 (GRCm39) probably null Het
Ergic1 A T 17: 26,857,801 (GRCm39) Y209F possibly damaging Het
Fbxw28 A G 9: 109,155,701 (GRCm39) I357T probably damaging Het
Flnb A T 14: 7,926,478 (GRCm38) T1841S probably benign Het
Foxc1 G A 13: 31,992,011 (GRCm39) S274N probably benign Het
Fto C T 8: 92,136,071 (GRCm39) T115M probably damaging Het
Gm10228 C G 16: 88,838,187 (GRCm39) C39S unknown Het
Gm7334 T C 17: 51,005,743 (GRCm39) F10L possibly damaging Het
Hfm1 A G 5: 107,029,727 (GRCm39) Y785H probably damaging Het
Hivep1 T A 13: 42,312,937 (GRCm39) S1726T probably benign Het
Htt G T 5: 35,009,534 (GRCm39) C1505F probably damaging Het
Hydin T C 8: 111,232,475 (GRCm39) S1665P possibly damaging Het
Ifi209 T A 1: 173,470,445 (GRCm39) N344K probably damaging Het
Ifnar2 T C 16: 91,196,181 (GRCm39) M262T probably benign Het
Ighv7-3 T A 12: 114,116,827 (GRCm39) S112C probably damaging Het
Igkv4-86 A G 6: 68,887,563 (GRCm39) S59P probably benign Het
Iglv1 A G 16: 18,904,239 (GRCm39) probably benign Het
Ipo7 T A 7: 109,652,006 (GRCm39) D928E possibly damaging Het
Itgae G T 11: 73,014,095 (GRCm39) probably null Het
Kbtbd12 T A 6: 88,595,179 (GRCm39) Q217L probably benign Het
Kcnma1 T A 14: 23,350,074 (GRCm39) Y1155F possibly damaging Het
Kif14 A G 1: 136,444,121 (GRCm39) E1371G probably benign Het
Lilrb4a A T 10: 51,367,142 (GRCm39) Y10F probably benign Het
Lrp2 A T 2: 69,333,732 (GRCm39) V1503E probably damaging Het
Mfsd6 A T 1: 52,747,799 (GRCm39) D355E probably benign Het
Mri1 T C 8: 84,977,657 (GRCm39) H226R Het
Mroh4 C T 15: 74,496,554 (GRCm39) E278K probably damaging Het
Muc4 T A 16: 32,574,739 (GRCm39) L1063H probably benign Het
Mzf1 A T 7: 12,778,018 (GRCm39) I541N probably damaging Het
Nasp T A 4: 116,469,230 (GRCm39) E116D probably benign Het
Nlrp10 T A 7: 108,525,033 (GRCm39) E149V probably damaging Het
Notch4 G A 17: 34,801,392 (GRCm39) C1080Y probably damaging Het
Nova1 T G 12: 46,767,481 (GRCm39) I147L unknown Het
Ogdh A G 11: 6,288,558 (GRCm39) M223V probably benign Het
Or2a56 T C 6: 42,932,723 (GRCm39) I97T probably benign Het
Or2y1e G T 11: 49,218,498 (GRCm39) A87S probably benign Het
Or4n4 A T 14: 50,518,945 (GRCm39) I255N probably damaging Het
Or6c66b G T 10: 129,377,324 (GRCm39) R306L probably benign Het
P3h3 T C 6: 124,831,395 (GRCm39) Q330R probably benign Het
Pcdhb10 A G 18: 37,544,935 (GRCm39) T4A not run Het
Pkd2l2 A T 18: 34,566,340 (GRCm39) probably null Het
Plekhb1 C T 7: 100,294,870 (GRCm39) V168I probably benign Het
Plxna4 C T 6: 32,200,915 (GRCm39) R753H probably damaging Het
Pramel17 T C 4: 101,694,338 (GRCm39) I182V possibly damaging Het
Prex1 G C 2: 166,555,629 (GRCm39) P4A unknown Het
Ptgdr A G 14: 45,096,535 (GRCm39) V59A probably damaging Het
Ralgapa1 T A 12: 55,804,740 (GRCm39) I519F probably benign Het
Rbpms A G 8: 34,279,481 (GRCm39) I170T probably benign Het
Sec31b T A 19: 44,512,274 (GRCm39) probably null Het
Skint11 A T 4: 114,084,905 (GRCm39) Y138F probably benign Het
Slain2 A G 5: 73,105,953 (GRCm39) Y196C probably damaging Het
Slco1b2 T A 6: 141,621,950 (GRCm39) C503* probably null Het
Slfn3 A T 11: 83,105,614 (GRCm39) Y537F possibly damaging Het
Slu7 T C 11: 43,335,592 (GRCm39) Y443H probably damaging Het
Sorl1 T A 9: 41,955,205 (GRCm39) E683D probably damaging Het
St8sia2 T A 7: 73,593,069 (GRCm39) Y329F probably damaging Het
Stra6l C A 4: 45,869,570 (GRCm39) S212* probably null Het
Syne3 C T 12: 104,963,754 (GRCm39) probably benign Het
Tenm4 T A 7: 96,544,899 (GRCm39) I2342N probably benign Het
Tescl T A 7: 24,032,688 (GRCm39) E212D probably benign Het
Trip11 A G 12: 101,811,114 (GRCm39) S1879P probably benign Het
Ube2c A T 2: 164,613,211 (GRCm39) probably null Het
Umodl1 T A 17: 31,205,430 (GRCm39) I675N probably benign Het
Vipr2 T C 12: 116,086,338 (GRCm39) F121S probably damaging Het
Vmn1r206 A T 13: 22,804,839 (GRCm39) S123T possibly damaging Het
Vmn1r58 A G 7: 5,413,912 (GRCm39) V106A probably damaging Het
Vmn2r112 A G 17: 22,822,099 (GRCm39) Y259C probably damaging Het
Vmn2r66 T C 7: 84,654,909 (GRCm39) K467E probably benign Het
Vmn2r98 T C 17: 19,300,797 (GRCm39) F600L probably benign Het
Vps13a T A 19: 16,723,364 (GRCm39) N278I possibly damaging Het
Vwa5a A C 9: 38,652,458 (GRCm39) D747A possibly damaging Het
Xdh G A 17: 74,241,829 (GRCm39) P157S possibly damaging Het
Xrn1 G A 9: 95,880,401 (GRCm39) probably null Het
Zfp362 T A 4: 128,680,824 (GRCm39) H180L probably benign Het
Zfp560 A T 9: 20,258,619 (GRCm39) W748R possibly damaging Het
Zfp808 A T 13: 62,320,478 (GRCm39) Q569L probably benign Het
Zfp93 T A 7: 23,974,643 (GRCm39) D209E possibly damaging Het
Zftraf1 A T 15: 76,542,747 (GRCm39) Y138N probably damaging Het
Other mutations in Sos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Sos1 APN 17 80,705,953 (GRCm39) missense possibly damaging 0.94
IGL00915:Sos1 APN 17 80,741,367 (GRCm39) missense probably benign 0.00
IGL00929:Sos1 APN 17 80,716,025 (GRCm39) missense probably damaging 1.00
IGL01073:Sos1 APN 17 80,730,176 (GRCm39) missense probably damaging 1.00
IGL01116:Sos1 APN 17 80,752,929 (GRCm39) missense probably damaging 1.00
IGL01533:Sos1 APN 17 80,722,511 (GRCm39) missense probably damaging 0.97
IGL01546:Sos1 APN 17 80,716,040 (GRCm39) missense probably damaging 1.00
IGL01583:Sos1 APN 17 80,741,329 (GRCm39) missense probably benign 0.11
IGL01628:Sos1 APN 17 80,730,106 (GRCm39) splice site probably benign
IGL01837:Sos1 APN 17 80,730,157 (GRCm39) missense probably damaging 1.00
IGL02170:Sos1 APN 17 80,705,719 (GRCm39) missense probably damaging 0.99
IGL02426:Sos1 APN 17 80,742,372 (GRCm39) missense possibly damaging 0.82
IGL02992:Sos1 APN 17 80,726,445 (GRCm39) missense probably benign 0.01
IGL03037:Sos1 APN 17 80,727,758 (GRCm39) missense probably damaging 0.98
1mM(1):Sos1 UTSW 17 80,762,486 (GRCm39) missense possibly damaging 0.46
BB007:Sos1 UTSW 17 80,714,267 (GRCm39) missense probably benign 0.00
BB017:Sos1 UTSW 17 80,714,267 (GRCm39) missense probably benign 0.00
PIT4354001:Sos1 UTSW 17 80,756,785 (GRCm39) missense possibly damaging 0.52
R0056:Sos1 UTSW 17 80,721,050 (GRCm39) missense probably damaging 1.00
R0348:Sos1 UTSW 17 80,715,740 (GRCm39) missense probably benign
R0373:Sos1 UTSW 17 80,761,192 (GRCm39) missense probably damaging 1.00
R0477:Sos1 UTSW 17 80,742,363 (GRCm39) missense possibly damaging 0.92
R0621:Sos1 UTSW 17 80,759,408 (GRCm39) critical splice donor site probably null
R0839:Sos1 UTSW 17 80,741,159 (GRCm39) missense probably damaging 1.00
R1174:Sos1 UTSW 17 80,753,037 (GRCm39) nonsense probably null
R1490:Sos1 UTSW 17 80,721,104 (GRCm39) missense probably benign 0.11
R1566:Sos1 UTSW 17 80,761,345 (GRCm39) missense probably damaging 0.99
R1635:Sos1 UTSW 17 80,730,108 (GRCm39) splice site probably null
R3412:Sos1 UTSW 17 80,714,146 (GRCm39) missense probably benign
R3770:Sos1 UTSW 17 80,705,737 (GRCm39) missense probably damaging 0.97
R3951:Sos1 UTSW 17 80,731,610 (GRCm39) missense probably damaging 1.00
R3964:Sos1 UTSW 17 80,762,608 (GRCm39) missense probably damaging 1.00
R3966:Sos1 UTSW 17 80,762,608 (GRCm39) missense probably damaging 1.00
R4086:Sos1 UTSW 17 80,756,781 (GRCm39) missense probably benign 0.06
R4087:Sos1 UTSW 17 80,756,781 (GRCm39) missense probably benign 0.06
R4089:Sos1 UTSW 17 80,756,781 (GRCm39) missense probably benign 0.06
R4194:Sos1 UTSW 17 80,706,013 (GRCm39) missense probably benign 0.02
R4468:Sos1 UTSW 17 80,761,240 (GRCm39) missense probably damaging 1.00
R4469:Sos1 UTSW 17 80,761,240 (GRCm39) missense probably damaging 1.00
R4597:Sos1 UTSW 17 80,741,255 (GRCm39) missense probably benign 0.05
R4773:Sos1 UTSW 17 80,705,660 (GRCm39) missense probably damaging 0.99
R4923:Sos1 UTSW 17 80,742,381 (GRCm39) missense probably benign 0.10
R5120:Sos1 UTSW 17 80,715,677 (GRCm39) missense probably damaging 0.98
R5478:Sos1 UTSW 17 80,741,276 (GRCm39) missense probably damaging 1.00
R5566:Sos1 UTSW 17 80,761,319 (GRCm39) missense possibly damaging 0.91
R5984:Sos1 UTSW 17 80,759,561 (GRCm39) missense possibly damaging 0.68
R6053:Sos1 UTSW 17 80,722,463 (GRCm39) missense possibly damaging 0.94
R6153:Sos1 UTSW 17 80,756,764 (GRCm39) missense probably benign 0.01
R6567:Sos1 UTSW 17 80,740,932 (GRCm39) missense probably damaging 1.00
R7392:Sos1 UTSW 17 80,731,629 (GRCm39) missense probably damaging 1.00
R7623:Sos1 UTSW 17 80,787,323 (GRCm39) missense probably benign 0.28
R7930:Sos1 UTSW 17 80,714,267 (GRCm39) missense probably benign 0.00
R8132:Sos1 UTSW 17 80,716,031 (GRCm39) missense probably damaging 1.00
R8236:Sos1 UTSW 17 80,715,712 (GRCm39) missense probably benign 0.41
R8322:Sos1 UTSW 17 80,715,728 (GRCm39) missense probably damaging 0.96
R8348:Sos1 UTSW 17 80,741,548 (GRCm39) missense probably benign 0.00
R8448:Sos1 UTSW 17 80,741,548 (GRCm39) missense probably benign 0.00
R8554:Sos1 UTSW 17 80,705,842 (GRCm39) missense probably damaging 0.99
R8850:Sos1 UTSW 17 80,741,405 (GRCm39) missense probably damaging 1.00
R8966:Sos1 UTSW 17 80,705,879 (GRCm39) missense possibly damaging 0.87
R9051:Sos1 UTSW 17 80,715,723 (GRCm39) missense probably benign
R9355:Sos1 UTSW 17 80,722,479 (GRCm39) missense possibly damaging 0.71
R9378:Sos1 UTSW 17 80,761,239 (GRCm39) missense probably damaging 1.00
R9576:Sos1 UTSW 17 80,742,367 (GRCm39) missense probably benign 0.11
X0020:Sos1 UTSW 17 80,756,706 (GRCm39) missense probably damaging 1.00
Z1177:Sos1 UTSW 17 80,761,347 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTGTGGATTTTCACATTAGGATGC -3'
(R):5'- GTCAAAGCTGATTATGAATGGGC -3'

Sequencing Primer
(F):5'- CTGAAAGGATTACGGTGCTACCTTC -3'
(R):5'- GGGCTATAATAGTTAGTTGTTCT -3'
Posted On 2019-11-26