Incidental Mutation 'R7763:Vps13a'
ID 598096
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Name vacuolar protein sorting 13A
Synonyms 4930543C13Rik, D330038K10Rik, 4930516E05Rik
MMRRC Submission 045819-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 16592730-16758297 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16723364 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 278 (N278I)
Ref Sequence ENSEMBL: ENSMUSP00000068716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000068156
AA Change: N278I

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: N278I

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224149
AA Change: N278I

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,113,825 (GRCm39) W899R probably damaging Het
Abca5 A T 11: 110,163,323 (GRCm39) W1631R possibly damaging Het
Actg2 T A 6: 83,504,350 (GRCm39) D25V probably damaging Het
Akap10 G C 11: 61,806,331 (GRCm39) D132E probably damaging Het
Angptl2 G T 2: 33,132,394 (GRCm39) E334* probably null Het
Aprt T C 8: 123,301,674 (GRCm39) R165G probably benign Het
Bmp1 A G 14: 70,729,524 (GRCm39) F549S probably damaging Het
Capzb C T 4: 139,007,864 (GRCm39) T215I probably benign Het
Car14 C T 3: 95,811,684 (GRCm39) M1I probably null Het
Ccdc148 T A 2: 58,713,648 (GRCm39) Q501L probably benign Het
Ccdc32 G A 2: 118,857,828 (GRCm39) T12I probably damaging Het
Ccnf G A 17: 24,443,986 (GRCm39) S594L probably damaging Het
Cdadc1 C T 14: 59,811,283 (GRCm39) C409Y probably damaging Het
Cdh23 G T 10: 60,148,356 (GRCm39) S2670R probably damaging Het
Cdh8 T A 8: 100,006,306 (GRCm39) K94* probably null Het
Cdhr2 A T 13: 54,865,505 (GRCm39) Y193F probably damaging Het
Cdon T A 9: 35,365,711 (GRCm39) Y153* probably null Het
Chd1 G A 17: 15,953,303 (GRCm39) G413R probably damaging Het
Cit A T 5: 116,125,060 (GRCm39) T1582S probably benign Het
Clec4a3 T C 6: 122,941,299 (GRCm39) L98P probably benign Het
Cpa4 T A 6: 30,583,644 (GRCm39) D253E probably damaging Het
Cyp2c40 T A 19: 39,795,612 (GRCm39) N189I possibly damaging Het
Daam2 G T 17: 49,797,050 (GRCm39) A245E probably benign Het
Dennd5b A G 6: 148,970,156 (GRCm39) F121S probably damaging Het
Dgkd A G 1: 87,854,671 (GRCm39) T658A probably benign Het
Dmwd T A 7: 18,814,265 (GRCm39) L305Q probably damaging Het
Dnah5 A T 15: 28,314,001 (GRCm39) Y1939F probably damaging Het
Dock5 T C 14: 68,058,776 (GRCm39) T512A probably damaging Het
Dop1b T A 16: 93,552,402 (GRCm39) D398E probably benign Het
Eef1akmt4 A G 16: 20,437,279 (GRCm39) H207R probably damaging Het
Egfr T C 11: 16,841,266 (GRCm39) V719A probably damaging Het
Ep300 A T 15: 81,470,784 (GRCm39) probably benign Het
Epha4 A G 1: 77,366,668 (GRCm39) probably null Het
Erc2 T G 14: 27,598,161 (GRCm39) probably null Het
Ergic1 A T 17: 26,857,801 (GRCm39) Y209F possibly damaging Het
Fbxw28 A G 9: 109,155,701 (GRCm39) I357T probably damaging Het
Flnb A T 14: 7,926,478 (GRCm38) T1841S probably benign Het
Foxc1 G A 13: 31,992,011 (GRCm39) S274N probably benign Het
Fto C T 8: 92,136,071 (GRCm39) T115M probably damaging Het
Gm10228 C G 16: 88,838,187 (GRCm39) C39S unknown Het
Gm7334 T C 17: 51,005,743 (GRCm39) F10L possibly damaging Het
Hfm1 A G 5: 107,029,727 (GRCm39) Y785H probably damaging Het
Hivep1 T A 13: 42,312,937 (GRCm39) S1726T probably benign Het
Htt G T 5: 35,009,534 (GRCm39) C1505F probably damaging Het
Hydin T C 8: 111,232,475 (GRCm39) S1665P possibly damaging Het
Ifi209 T A 1: 173,470,445 (GRCm39) N344K probably damaging Het
Ifnar2 T C 16: 91,196,181 (GRCm39) M262T probably benign Het
Ighv7-3 T A 12: 114,116,827 (GRCm39) S112C probably damaging Het
Igkv4-86 A G 6: 68,887,563 (GRCm39) S59P probably benign Het
Iglv1 A G 16: 18,904,239 (GRCm39) probably benign Het
Ipo7 T A 7: 109,652,006 (GRCm39) D928E possibly damaging Het
Itgae G T 11: 73,014,095 (GRCm39) probably null Het
Kbtbd12 T A 6: 88,595,179 (GRCm39) Q217L probably benign Het
Kcnma1 T A 14: 23,350,074 (GRCm39) Y1155F possibly damaging Het
Kif14 A G 1: 136,444,121 (GRCm39) E1371G probably benign Het
Lilrb4a A T 10: 51,367,142 (GRCm39) Y10F probably benign Het
Lrp2 A T 2: 69,333,732 (GRCm39) V1503E probably damaging Het
Mfsd6 A T 1: 52,747,799 (GRCm39) D355E probably benign Het
Mri1 T C 8: 84,977,657 (GRCm39) H226R Het
Mroh4 C T 15: 74,496,554 (GRCm39) E278K probably damaging Het
Muc4 T A 16: 32,574,739 (GRCm39) L1063H probably benign Het
Mzf1 A T 7: 12,778,018 (GRCm39) I541N probably damaging Het
Nasp T A 4: 116,469,230 (GRCm39) E116D probably benign Het
Nlrp10 T A 7: 108,525,033 (GRCm39) E149V probably damaging Het
Notch4 G A 17: 34,801,392 (GRCm39) C1080Y probably damaging Het
Nova1 T G 12: 46,767,481 (GRCm39) I147L unknown Het
Ogdh A G 11: 6,288,558 (GRCm39) M223V probably benign Het
Or2a56 T C 6: 42,932,723 (GRCm39) I97T probably benign Het
Or2y1e G T 11: 49,218,498 (GRCm39) A87S probably benign Het
Or4n4 A T 14: 50,518,945 (GRCm39) I255N probably damaging Het
Or6c66b G T 10: 129,377,324 (GRCm39) R306L probably benign Het
P3h3 T C 6: 124,831,395 (GRCm39) Q330R probably benign Het
Pcdhb10 A G 18: 37,544,935 (GRCm39) T4A not run Het
Pkd2l2 A T 18: 34,566,340 (GRCm39) probably null Het
Plekhb1 C T 7: 100,294,870 (GRCm39) V168I probably benign Het
Plxna4 C T 6: 32,200,915 (GRCm39) R753H probably damaging Het
Pramel17 T C 4: 101,694,338 (GRCm39) I182V possibly damaging Het
Prex1 G C 2: 166,555,629 (GRCm39) P4A unknown Het
Ptgdr A G 14: 45,096,535 (GRCm39) V59A probably damaging Het
Ralgapa1 T A 12: 55,804,740 (GRCm39) I519F probably benign Het
Rbpms A G 8: 34,279,481 (GRCm39) I170T probably benign Het
Sec31b T A 19: 44,512,274 (GRCm39) probably null Het
Skint11 A T 4: 114,084,905 (GRCm39) Y138F probably benign Het
Slain2 A G 5: 73,105,953 (GRCm39) Y196C probably damaging Het
Slco1b2 T A 6: 141,621,950 (GRCm39) C503* probably null Het
Slfn3 A T 11: 83,105,614 (GRCm39) Y537F possibly damaging Het
Slu7 T C 11: 43,335,592 (GRCm39) Y443H probably damaging Het
Sorl1 T A 9: 41,955,205 (GRCm39) E683D probably damaging Het
Sos1 T A 17: 80,721,142 (GRCm39) I893L probably benign Het
St8sia2 T A 7: 73,593,069 (GRCm39) Y329F probably damaging Het
Stra6l C A 4: 45,869,570 (GRCm39) S212* probably null Het
Syne3 C T 12: 104,963,754 (GRCm39) probably benign Het
Tenm4 T A 7: 96,544,899 (GRCm39) I2342N probably benign Het
Tescl T A 7: 24,032,688 (GRCm39) E212D probably benign Het
Trip11 A G 12: 101,811,114 (GRCm39) S1879P probably benign Het
Ube2c A T 2: 164,613,211 (GRCm39) probably null Het
Umodl1 T A 17: 31,205,430 (GRCm39) I675N probably benign Het
Vipr2 T C 12: 116,086,338 (GRCm39) F121S probably damaging Het
Vmn1r206 A T 13: 22,804,839 (GRCm39) S123T possibly damaging Het
Vmn1r58 A G 7: 5,413,912 (GRCm39) V106A probably damaging Het
Vmn2r112 A G 17: 22,822,099 (GRCm39) Y259C probably damaging Het
Vmn2r66 T C 7: 84,654,909 (GRCm39) K467E probably benign Het
Vmn2r98 T C 17: 19,300,797 (GRCm39) F600L probably benign Het
Vwa5a A C 9: 38,652,458 (GRCm39) D747A possibly damaging Het
Xdh G A 17: 74,241,829 (GRCm39) P157S possibly damaging Het
Xrn1 G A 9: 95,880,401 (GRCm39) probably null Het
Zfp362 T A 4: 128,680,824 (GRCm39) H180L probably benign Het
Zfp560 A T 9: 20,258,619 (GRCm39) W748R possibly damaging Het
Zfp808 A T 13: 62,320,478 (GRCm39) Q569L probably benign Het
Zfp93 T A 7: 23,974,643 (GRCm39) D209E possibly damaging Het
Zftraf1 A T 15: 76,542,747 (GRCm39) Y138N probably damaging Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16,729,539 (GRCm39) missense probably damaging 0.98
IGL00537:Vps13a APN 19 16,657,409 (GRCm39) missense probably benign 0.03
IGL00562:Vps13a APN 19 16,712,078 (GRCm39) critical splice donor site probably null
IGL00563:Vps13a APN 19 16,712,078 (GRCm39) critical splice donor site probably null
IGL00579:Vps13a APN 19 16,684,726 (GRCm39) missense probably benign 0.29
IGL00662:Vps13a APN 19 16,681,904 (GRCm39) missense probably damaging 0.96
IGL00667:Vps13a APN 19 16,737,040 (GRCm39) missense probably damaging 1.00
IGL01102:Vps13a APN 19 16,628,781 (GRCm39) critical splice donor site probably null
IGL01139:Vps13a APN 19 16,617,989 (GRCm39) missense probably damaging 0.99
IGL01142:Vps13a APN 19 16,664,479 (GRCm39) missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16,720,371 (GRCm39) missense probably damaging 1.00
IGL01386:Vps13a APN 19 16,678,516 (GRCm39) missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16,739,545 (GRCm39) missense probably damaging 0.98
IGL01700:Vps13a APN 19 16,722,221 (GRCm39) nonsense probably null
IGL01767:Vps13a APN 19 16,641,258 (GRCm39) missense probably damaging 1.00
IGL01782:Vps13a APN 19 16,731,701 (GRCm39) missense probably damaging 0.98
IGL01808:Vps13a APN 19 16,687,650 (GRCm39) missense probably damaging 1.00
IGL01812:Vps13a APN 19 16,692,424 (GRCm39) missense probably benign
IGL01829:Vps13a APN 19 16,596,807 (GRCm39) missense probably benign 0.01
IGL01893:Vps13a APN 19 16,641,139 (GRCm39) missense probably damaging 1.00
IGL02222:Vps13a APN 19 16,659,539 (GRCm39) missense probably benign 0.06
IGL02295:Vps13a APN 19 16,692,406 (GRCm39) splice site probably benign
IGL02465:Vps13a APN 19 16,688,305 (GRCm39) missense probably benign 0.11
IGL02492:Vps13a APN 19 16,625,001 (GRCm39) missense probably damaging 1.00
IGL02581:Vps13a APN 19 16,632,686 (GRCm39) missense probably benign 0.41
IGL02633:Vps13a APN 19 16,697,772 (GRCm39) missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16,676,185 (GRCm39) missense probably benign 0.01
IGL02659:Vps13a APN 19 16,630,063 (GRCm39) missense probably damaging 1.00
IGL02827:Vps13a APN 19 16,618,998 (GRCm39) missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16,641,250 (GRCm39) missense probably damaging 1.00
IGL03057:Vps13a APN 19 16,646,058 (GRCm39) missense probably damaging 1.00
IGL03077:Vps13a APN 19 16,688,246 (GRCm39) missense probably benign
IGL03184:Vps13a APN 19 16,631,734 (GRCm39) missense probably benign 0.00
eggs UTSW 19 16,678,529 (GRCm39) missense probably damaging 1.00
excambio UTSW 19 16,723,311 (GRCm39) splice site probably null
Faster UTSW 19 16,596,849 (GRCm39) missense probably damaging 1.00
Ham UTSW 19 16,655,333 (GRCm39) missense probably benign 0.08
interchange UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16,718,265 (GRCm39) missense probably damaging 1.00
R0045:Vps13a UTSW 19 16,618,174 (GRCm39) nonsense probably null
R0045:Vps13a UTSW 19 16,618,174 (GRCm39) nonsense probably null
R0048:Vps13a UTSW 19 16,653,504 (GRCm39) missense probably damaging 1.00
R0062:Vps13a UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
R0062:Vps13a UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
R0107:Vps13a UTSW 19 16,669,188 (GRCm39) missense probably benign 0.03
R0135:Vps13a UTSW 19 16,758,129 (GRCm39) missense probably damaging 1.00
R0138:Vps13a UTSW 19 16,637,863 (GRCm39) missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16,655,333 (GRCm39) missense probably benign 0.08
R0359:Vps13a UTSW 19 16,618,941 (GRCm39) missense probably damaging 0.99
R0530:Vps13a UTSW 19 16,632,570 (GRCm39) splice site probably benign
R0541:Vps13a UTSW 19 16,681,941 (GRCm39) missense probably benign 0.00
R0614:Vps13a UTSW 19 16,630,058 (GRCm39) missense probably damaging 1.00
R0685:Vps13a UTSW 19 16,758,105 (GRCm39) missense probably damaging 1.00
R0801:Vps13a UTSW 19 16,664,020 (GRCm39) splice site probably benign
R0835:Vps13a UTSW 19 16,712,246 (GRCm39) splice site probably null
R0848:Vps13a UTSW 19 16,676,261 (GRCm39) missense probably damaging 1.00
R1114:Vps13a UTSW 19 16,727,515 (GRCm39) missense probably benign 0.41
R1205:Vps13a UTSW 19 16,617,905 (GRCm39) missense probably damaging 1.00
R1365:Vps13a UTSW 19 16,596,810 (GRCm39) missense probably damaging 1.00
R1445:Vps13a UTSW 19 16,678,602 (GRCm39) nonsense probably null
R1451:Vps13a UTSW 19 16,688,228 (GRCm39) missense probably benign 0.01
R1479:Vps13a UTSW 19 16,727,478 (GRCm39) splice site probably benign
R1533:Vps13a UTSW 19 16,678,494 (GRCm39) nonsense probably null
R1600:Vps13a UTSW 19 16,643,636 (GRCm39) missense probably benign 0.01
R1870:Vps13a UTSW 19 16,737,316 (GRCm39) missense probably damaging 1.00
R1871:Vps13a UTSW 19 16,642,028 (GRCm39) missense probably benign 0.01
R1959:Vps13a UTSW 19 16,655,302 (GRCm39) missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16,702,995 (GRCm39) missense probably damaging 1.00
R1993:Vps13a UTSW 19 16,699,822 (GRCm39) missense probably benign 0.07
R2257:Vps13a UTSW 19 16,659,538 (GRCm39) missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16,687,790 (GRCm39) missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16,720,421 (GRCm39) missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16,697,817 (GRCm39) missense probably damaging 1.00
R2359:Vps13a UTSW 19 16,630,043 (GRCm39) splice site probably benign
R2421:Vps13a UTSW 19 16,737,035 (GRCm39) missense probably benign
R2847:Vps13a UTSW 19 16,680,963 (GRCm39) missense probably damaging 0.98
R3081:Vps13a UTSW 19 16,642,101 (GRCm39) missense probably benign 0.02
R3522:Vps13a UTSW 19 16,743,857 (GRCm39) splice site probably benign
R3613:Vps13a UTSW 19 16,662,766 (GRCm39) missense probably damaging 1.00
R3797:Vps13a UTSW 19 16,723,311 (GRCm39) splice site probably null
R3874:Vps13a UTSW 19 16,722,317 (GRCm39) missense probably benign 0.01
R4032:Vps13a UTSW 19 16,594,263 (GRCm39) missense probably damaging 1.00
R4111:Vps13a UTSW 19 16,617,992 (GRCm39) missense probably damaging 1.00
R4383:Vps13a UTSW 19 16,678,529 (GRCm39) missense probably damaging 1.00
R4504:Vps13a UTSW 19 16,672,866 (GRCm39) missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16,659,474 (GRCm39) missense probably damaging 0.98
R4587:Vps13a UTSW 19 16,617,403 (GRCm39) missense probably damaging 1.00
R4588:Vps13a UTSW 19 16,617,403 (GRCm39) missense probably damaging 1.00
R4605:Vps13a UTSW 19 16,617,403 (GRCm39) missense probably damaging 1.00
R4714:Vps13a UTSW 19 16,727,220 (GRCm39) missense probably benign 0.01
R4756:Vps13a UTSW 19 16,632,580 (GRCm39) missense probably benign 0.01
R4831:Vps13a UTSW 19 16,655,356 (GRCm39) missense probably benign 0.04
R5068:Vps13a UTSW 19 16,723,422 (GRCm39) missense probably benign 0.01
R5070:Vps13a UTSW 19 16,631,848 (GRCm39) missense probably benign
R5082:Vps13a UTSW 19 16,722,257 (GRCm39) missense probably damaging 1.00
R5182:Vps13a UTSW 19 16,672,863 (GRCm39) missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16,662,679 (GRCm39) missense probably damaging 1.00
R5283:Vps13a UTSW 19 16,655,334 (GRCm39) missense probably damaging 0.96
R5294:Vps13a UTSW 19 16,619,031 (GRCm39) missense probably damaging 1.00
R5304:Vps13a UTSW 19 16,687,751 (GRCm39) missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16,699,775 (GRCm39) missense probably damaging 1.00
R5592:Vps13a UTSW 19 16,702,935 (GRCm39) missense probably damaging 1.00
R5611:Vps13a UTSW 19 16,702,936 (GRCm39) missense probably damaging 1.00
R5665:Vps13a UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
R5671:Vps13a UTSW 19 16,692,464 (GRCm39) missense probably benign 0.03
R5684:Vps13a UTSW 19 16,676,409 (GRCm39) missense probably benign 0.00
R5767:Vps13a UTSW 19 16,641,928 (GRCm39) missense probably damaging 1.00
R5810:Vps13a UTSW 19 16,643,688 (GRCm39) missense probably benign 0.00
R5866:Vps13a UTSW 19 16,657,387 (GRCm39) missense probably benign 0.04
R5886:Vps13a UTSW 19 16,641,926 (GRCm39) missense probably benign 0.01
R5933:Vps13a UTSW 19 16,637,894 (GRCm39) missense probably benign 0.34
R5965:Vps13a UTSW 19 16,596,392 (GRCm39) splice site probably null
R6259:Vps13a UTSW 19 16,664,534 (GRCm39) nonsense probably null
R6346:Vps13a UTSW 19 16,659,578 (GRCm39) missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16,641,382 (GRCm39) missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16,657,414 (GRCm39) missense probably damaging 0.99
R6520:Vps13a UTSW 19 16,702,943 (GRCm39) missense probably damaging 1.00
R6644:Vps13a UTSW 19 16,722,283 (GRCm39) missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16,655,439 (GRCm39) missense probably benign 0.01
R6934:Vps13a UTSW 19 16,653,558 (GRCm39) missense probably damaging 1.00
R6951:Vps13a UTSW 19 16,701,104 (GRCm39) missense probably benign 0.00
R7027:Vps13a UTSW 19 16,642,028 (GRCm39) missense probably benign 0.01
R7126:Vps13a UTSW 19 16,688,243 (GRCm39) missense probably benign
R7206:Vps13a UTSW 19 16,731,662 (GRCm39) missense probably damaging 1.00
R7248:Vps13a UTSW 19 16,655,406 (GRCm39) missense probably benign 0.25
R7252:Vps13a UTSW 19 16,638,428 (GRCm39) missense probably benign 0.00
R7255:Vps13a UTSW 19 16,631,703 (GRCm39) critical splice donor site probably null
R7382:Vps13a UTSW 19 16,596,849 (GRCm39) missense probably damaging 1.00
R7422:Vps13a UTSW 19 16,727,537 (GRCm39) missense probably damaging 1.00
R7425:Vps13a UTSW 19 16,701,066 (GRCm39) missense probably benign 0.13
R7523:Vps13a UTSW 19 16,681,153 (GRCm39) missense probably benign
R7586:Vps13a UTSW 19 16,624,962 (GRCm39) missense probably benign 0.08
R7587:Vps13a UTSW 19 16,681,153 (GRCm39) missense probably benign 0.00
R7593:Vps13a UTSW 19 16,703,027 (GRCm39) missense probably damaging 1.00
R7637:Vps13a UTSW 19 16,727,513 (GRCm39) missense probably benign 0.02
R7813:Vps13a UTSW 19 16,628,820 (GRCm39) missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16,702,936 (GRCm39) missense probably damaging 1.00
R7861:Vps13a UTSW 19 16,632,668 (GRCm39) missense probably damaging 1.00
R7909:Vps13a UTSW 19 16,697,794 (GRCm39) nonsense probably null
R7939:Vps13a UTSW 19 16,718,155 (GRCm39) missense possibly damaging 0.94
R8108:Vps13a UTSW 19 16,618,151 (GRCm39) missense probably damaging 1.00
R8123:Vps13a UTSW 19 16,625,066 (GRCm39) missense probably benign 0.01
R8134:Vps13a UTSW 19 16,631,718 (GRCm39) missense possibly damaging 0.71
R8168:Vps13a UTSW 19 16,726,912 (GRCm39) missense probably benign 0.09
R8272:Vps13a UTSW 19 16,727,209 (GRCm39) critical splice donor site probably null
R8293:Vps13a UTSW 19 16,645,969 (GRCm39) missense possibly damaging 0.81
R8303:Vps13a UTSW 19 16,594,270 (GRCm39) missense probably benign 0.00
R8383:Vps13a UTSW 19 16,701,069 (GRCm39) missense possibly damaging 0.83
R8386:Vps13a UTSW 19 16,678,483 (GRCm39) critical splice donor site probably null
R8433:Vps13a UTSW 19 16,718,600 (GRCm39) missense possibly damaging 0.56
R8436:Vps13a UTSW 19 16,718,157 (GRCm39) missense probably benign 0.10
R8450:Vps13a UTSW 19 16,631,871 (GRCm39) splice site probably null
R8476:Vps13a UTSW 19 16,699,821 (GRCm39) missense possibly damaging 0.60
R8501:Vps13a UTSW 19 16,659,484 (GRCm39) missense probably benign 0.39
R8552:Vps13a UTSW 19 16,731,684 (GRCm39) missense probably damaging 0.99
R8680:Vps13a UTSW 19 16,623,270 (GRCm39) missense possibly damaging 0.84
R8784:Vps13a UTSW 19 16,642,153 (GRCm39) missense probably damaging 1.00
R8871:Vps13a UTSW 19 16,641,186 (GRCm39) missense probably damaging 1.00
R8945:Vps13a UTSW 19 16,642,114 (GRCm39) missense probably damaging 1.00
R8948:Vps13a UTSW 19 16,723,340 (GRCm39) missense probably damaging 0.99
R8950:Vps13a UTSW 19 16,723,340 (GRCm39) missense probably damaging 0.99
R8960:Vps13a UTSW 19 16,683,247 (GRCm39) missense possibly damaging 0.67
R9189:Vps13a UTSW 19 16,663,961 (GRCm39) missense probably benign
R9366:Vps13a UTSW 19 16,672,894 (GRCm39) missense probably damaging 1.00
R9505:Vps13a UTSW 19 16,719,908 (GRCm39) missense possibly damaging 0.94
R9601:Vps13a UTSW 19 16,623,337 (GRCm39) missense possibly damaging 0.84
R9735:Vps13a UTSW 19 16,701,111 (GRCm39) missense probably damaging 1.00
R9776:Vps13a UTSW 19 16,736,958 (GRCm39) missense probably benign
R9796:Vps13a UTSW 19 16,631,828 (GRCm39) missense probably benign 0.01
X0061:Vps13a UTSW 19 16,623,232 (GRCm39) missense probably benign 0.40
X0066:Vps13a UTSW 19 16,719,917 (GRCm39) missense probably benign 0.33
Z1177:Vps13a UTSW 19 16,676,477 (GRCm39) critical splice acceptor site probably null
Z31818:Vps13a UTSW 19 16,758,118 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTTACATCTTTCCGGGGTC -3'
(R):5'- CCAAAGTAGTGTGGGTACTGG -3'

Sequencing Primer
(F):5'- CGGGGTCCTGTTCAGCTACTG -3'
(R):5'- ACTGGGGCTGTGGAGAG -3'
Posted On 2019-11-26