Mutagenetix > Incidental Mutation

Incidental Mutation 'R7763:Vps13a'

598096

Institutional Source

Beutler Lab

Gene Symbol

Vps13a

Ensembl Gene

ENSMUSG00000046230

Gene Name

vacuolar protein sorting 13A

Synonyms

4930516E05Rik, 4930543C13Rik, D330038K10Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16615366-16780933 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16746000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 278 (N278I)

Ref Sequence

ENSEMBL: ENSMUSP00000068716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068156
AA Change: N278I

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: N278I

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	5.4e-38	PFAM
Pfam:VPS13	139	371	3.7e-64	PFAM
low complexity region	553	563	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	567	791	1.4e-69	PFAM
Pfam:VPS13_mid_rpt	1138	1329	2e-10	PFAM
low complexity region	1367	1377	N/A	INTRINSIC
Blast:INB	1575	1855	1e-149	BLAST
Pfam:SHR-BD	2200	2449	1.3e-35	PFAM
low complexity region	2510	2521	N/A	INTRINSIC
low complexity region	2632	2648	N/A	INTRINSIC
low complexity region	2719	2731	N/A	INTRINSIC
Pfam:VPS13_C	2755	2935	8.9e-66	PFAM
Pfam:ATG_C	2938	3029	1.6e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224149
AA Change: N278I

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,514,602	W899R	probably damaging	Het
Abca5	A	T	11: 110,272,497	W1631R	possibly damaging	Het
Actg2	T	A	6: 83,527,368	D25V	probably damaging	Het
Akap10	G	C	11: 61,915,505	D132E	probably damaging	Het
Angptl2	G	T	2: 33,242,382	E334*	probably null	Het
Aprt	T	C	8: 122,574,935	R165G	probably benign	Het
B020004J07Rik	T	C	4: 101,837,141	I182V	possibly damaging	Het
Bmp1	A	G	14: 70,492,084	F549S	probably damaging	Het
Capzb	C	T	4: 139,280,553	T215I	probably benign	Het
Car14	C	T	3: 95,904,372	M1I	probably null	Het
Ccdc148	T	A	2: 58,823,636	Q501L	probably benign	Het
Ccdc32	G	A	2: 119,027,347	T12I	probably damaging	Het
Ccnf	G	A	17: 24,225,012	S594L	probably damaging	Het
Cdadc1	C	T	14: 59,573,834	C409Y	probably damaging	Het
Cdh23	G	T	10: 60,312,577	S2670R	probably damaging	Het
Cdh8	T	A	8: 99,279,674	K94*	probably null	Het
Cdhr2	A	T	13: 54,717,692	Y193F	probably damaging	Het
Cdon	T	A	9: 35,454,415	Y153*	probably null	Het
Chd1	G	A	17: 15,733,041	G413R	probably damaging	Het
Cit	A	T	5: 115,987,001	T1582S	probably benign	Het
Clec4a3	T	C	6: 122,964,340	L98P	probably benign	Het
Cpa4	T	A	6: 30,583,645	D253E	probably damaging	Het
Cyhr1	A	T	15: 76,658,547	Y138N	probably damaging	Het
Cyp2c40	T	A	19: 39,807,168	N189I	possibly damaging	Het
Daam2	G	T	17: 49,490,022	A245E	probably benign	Het
Dennd5b	A	G	6: 149,068,658	F121S	probably damaging	Het
Dgkd	A	G	1: 87,926,949	T658A	probably benign	Het
Dmwd	T	A	7: 19,080,340	L305Q	probably damaging	Het
Dnah5	A	T	15: 28,313,855	Y1939F	probably damaging	Het
Dock5	T	C	14: 67,821,327	T512A	probably damaging	Het
Dopey2	T	A	16: 93,755,514	D398E	probably benign	Het
Eef1akmt4	A	G	16: 20,618,529	H207R	probably damaging	Het
Egfr	T	C	11: 16,891,266	V719A	probably damaging	Het
Ep300	A	T	15: 81,586,583		probably benign	Het
Epha4	A	G	1: 77,390,031		probably null	Het
Erc2	T	G	14: 27,876,204		probably null	Het
Ergic1	A	T	17: 26,638,827	Y209F	possibly damaging	Het
Fbxw28	A	G	9: 109,326,633	I357T	probably damaging	Het
Flnb	A	T	14: 7,926,478	T1841S	probably benign	Het
Foxc1	G	A	13: 31,808,028	S274N	probably benign	Het
Fto	C	T	8: 91,409,443	T115M	probably damaging	Het
Gm10228	C	G	16: 89,041,299	C39S	unknown	Het
Gm7334	T	C	17: 50,698,715	F10L	possibly damaging	Het
Hfm1	A	G	5: 106,881,861	Y785H	probably damaging	Het
Hivep1	T	A	13: 42,159,461	S1726T	probably benign	Het
Htt	G	T	5: 34,852,190	C1505F	probably damaging	Het
Hydin	T	C	8: 110,505,843	S1665P	possibly damaging	Het
Ifi209	T	A	1: 173,642,879	N344K	probably damaging	Het
Ifnar2	T	C	16: 91,399,293	M262T	probably benign	Het
Ighv7-3	T	A	12: 114,153,207	S112C	probably damaging	Het
Igkv4-86	A	G	6: 68,910,579	S59P	probably benign	Het
Iglv1	A	G	16: 19,085,489		probably benign	Het
Ipo7	T	A	7: 110,052,799	D928E	possibly damaging	Het
Itgae	G	T	11: 73,123,269		probably null	Het
Kbtbd12	T	A	6: 88,618,197	Q217L	probably benign	Het
Kcnma1	T	A	14: 23,300,006	Y1155F	possibly damaging	Het
Kif14	A	G	1: 136,516,383	E1371G	probably benign	Het
Lilrb4a	A	T	10: 51,491,046	Y10F	probably benign	Het
Lrp2	A	T	2: 69,503,388	V1503E	probably damaging	Het
Mfsd6	A	T	1: 52,708,640	D355E	probably benign	Het
Mri1	T	C	8: 84,251,028	H226R		Het
Mroh4	C	T	15: 74,624,705	E278K	probably damaging	Het
Muc4	T	A	16: 32,753,311	L1063H	probably benign	Het
Mzf1	A	T	7: 13,044,091	I541N	probably damaging	Het
Nasp	T	A	4: 116,612,033	E116D	probably benign	Het
Nlrp10	T	A	7: 108,925,826	E149V	probably damaging	Het
Notch4	G	A	17: 34,582,418	C1080Y	probably damaging	Het
Nova1	T	G	12: 46,720,698	I147L	unknown	Het
Ogdh	A	G	11: 6,338,558	M223V	probably benign	Het
Olfr1391	G	T	11: 49,327,671	A87S	probably benign	Het
Olfr444	T	C	6: 42,955,789	I97T	probably benign	Het
Olfr732	A	T	14: 50,281,488	I255N	probably damaging	Het
Olfr792	G	T	10: 129,541,455	R306L	probably benign	Het
P3h3	T	C	6: 124,854,432	Q330R	probably benign	Het
Pcdhb10	A	G	18: 37,411,882	T4A	not run	Het
Pkd2l2	A	T	18: 34,433,287		probably null	Het
Plekhb1	C	T	7: 100,645,663	V168I	probably benign	Het
Plxna4	C	T	6: 32,223,980	R753H	probably damaging	Het
Prex1	G	C	2: 166,713,709	P4A	unknown	Het
Ptgdr	A	G	14: 44,859,078	V59A	probably damaging	Het
Ralgapa1	T	A	12: 55,757,955	I519F	probably benign	Het
Rbpms	A	G	8: 33,789,453	I170T	probably benign	Het
Sec31b	T	A	19: 44,523,835		probably null	Het
Skint11	A	T	4: 114,227,708	Y138F	probably benign	Het
Slain2	A	G	5: 72,948,610	Y196C	probably damaging	Het
Slco1b2	T	A	6: 141,676,224	C503*	probably null	Het
Slfn3	A	T	11: 83,214,788	Y537F	possibly damaging	Het
Slu7	T	C	11: 43,444,765	Y443H	probably damaging	Het
Sorl1	T	A	9: 42,043,909	E683D	probably damaging	Het
Sos1	T	A	17: 80,413,713	I893L	probably benign	Het
St8sia2	T	A	7: 73,943,321	Y329F	probably damaging	Het
Stra6l	C	A	4: 45,869,570	S212*	probably null	Het
Syne3	C	T	12: 104,997,495		probably benign	Het
Tenm4	T	A	7: 96,895,692	I2342N	probably benign	Het
Tescl	T	A	7: 24,333,263	E212D	probably benign	Het
Trip11	A	G	12: 101,844,855	S1879P	probably benign	Het
Ube2c	A	T	2: 164,771,291		probably null	Het
Umodl1	T	A	17: 30,986,456	I675N	probably benign	Het
Vipr2	T	C	12: 116,122,718	F121S	probably damaging	Het
Vmn1r206	A	T	13: 22,620,669	S123T	possibly damaging	Het
Vmn1r58	A	G	7: 5,410,913	V106A	probably damaging	Het
Vmn2r112	A	G	17: 22,603,118	Y259C	probably damaging	Het
Vmn2r66	T	C	7: 85,005,701	K467E	probably benign	Het
Vmn2r98	T	C	17: 19,080,535	F600L	probably benign	Het
Vwa5a	A	C	9: 38,741,162	D747A	possibly damaging	Het
Xdh	G	A	17: 73,934,834	P157S	possibly damaging	Het
Xrn1	G	A	9: 95,998,348		probably null	Het
Zfp362	T	A	4: 128,787,031	H180L	probably benign	Het
Zfp560	A	T	9: 20,347,323	W748R	possibly damaging	Het
Zfp808	A	T	13: 62,172,664	Q569L	probably benign	Het
Zfp93	T	A	7: 24,275,218	D209E	possibly damaging	Het

Other mutations in Vps13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Vps13a	APN	19	16752175	missense	probably damaging	0.98
IGL00537:Vps13a	APN	19	16680045	missense	probably benign	0.03
IGL00562:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00563:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00579:Vps13a	APN	19	16707362	missense	probably benign	0.29
IGL00662:Vps13a	APN	19	16704540	missense	probably damaging	0.96
IGL00667:Vps13a	APN	19	16759676	missense	probably damaging	1.00
IGL01102:Vps13a	APN	19	16651417	critical splice donor site	probably null
IGL01139:Vps13a	APN	19	16640625	missense	probably damaging	0.99
IGL01142:Vps13a	APN	19	16687115	missense	possibly damaging	0.86
IGL01361:Vps13a	APN	19	16743007	missense	probably damaging	1.00
IGL01386:Vps13a	APN	19	16701152	missense	possibly damaging	0.87
IGL01593:Vps13a	APN	19	16762181	missense	probably damaging	0.98
IGL01700:Vps13a	APN	19	16744857	nonsense	probably null
IGL01767:Vps13a	APN	19	16663894	missense	probably damaging	1.00
IGL01782:Vps13a	APN	19	16754337	missense	probably damaging	0.98
IGL01808:Vps13a	APN	19	16710286	missense	probably damaging	1.00
IGL01812:Vps13a	APN	19	16715060	missense	probably benign
IGL01829:Vps13a	APN	19	16619443	missense	probably benign	0.01
IGL01893:Vps13a	APN	19	16663775	missense	probably damaging	1.00
IGL02222:Vps13a	APN	19	16682175	missense	probably benign	0.06
IGL02295:Vps13a	APN	19	16715042	splice site	probably benign
IGL02465:Vps13a	APN	19	16710941	missense	probably benign	0.11
IGL02492:Vps13a	APN	19	16647637	missense	probably damaging	1.00
IGL02581:Vps13a	APN	19	16655322	missense	probably benign	0.41
IGL02633:Vps13a	APN	19	16720408	missense	possibly damaging	0.82
IGL02641:Vps13a	APN	19	16698821	missense	probably benign	0.01
IGL02659:Vps13a	APN	19	16652699	missense	probably damaging	1.00
IGL02827:Vps13a	APN	19	16641634	missense	possibly damaging	0.91
IGL02943:Vps13a	APN	19	16663886	missense	probably damaging	1.00
IGL03057:Vps13a	APN	19	16668694	missense	probably damaging	1.00
IGL03077:Vps13a	APN	19	16710882	missense	probably benign
IGL03184:Vps13a	APN	19	16654370	missense	probably benign	0.00
eggs	UTSW	19	16701165	missense	probably damaging	1.00
excambio	UTSW	19	16745947	splice site	probably null
Faster	UTSW	19	16619485	missense	probably damaging	1.00
Ham	UTSW	19	16677969	missense	probably benign	0.08
interchange	UTSW	19	16668690	missense	probably damaging	1.00
PIT4377001:Vps13a	UTSW	19	16740901	missense	probably damaging	1.00
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0048:Vps13a	UTSW	19	16676140	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0107:Vps13a	UTSW	19	16691824	missense	probably benign	0.03
R0135:Vps13a	UTSW	19	16780765	missense	probably damaging	1.00
R0138:Vps13a	UTSW	19	16660499	missense	possibly damaging	0.95
R0346:Vps13a	UTSW	19	16677969	missense	probably benign	0.08
R0359:Vps13a	UTSW	19	16641577	missense	probably damaging	0.99
R0530:Vps13a	UTSW	19	16655206	splice site	probably benign
R0541:Vps13a	UTSW	19	16704577	missense	probably benign	0.00
R0614:Vps13a	UTSW	19	16652694	missense	probably damaging	1.00
R0685:Vps13a	UTSW	19	16780741	missense	probably damaging	1.00
R0801:Vps13a	UTSW	19	16686656	splice site	probably benign
R0835:Vps13a	UTSW	19	16734882	splice site	probably null
R0848:Vps13a	UTSW	19	16698897	missense	probably damaging	1.00
R1114:Vps13a	UTSW	19	16750151	missense	probably benign	0.41
R1205:Vps13a	UTSW	19	16640541	missense	probably damaging	1.00
R1365:Vps13a	UTSW	19	16619446	missense	probably damaging	1.00
R1445:Vps13a	UTSW	19	16701238	nonsense	probably null
R1451:Vps13a	UTSW	19	16710864	missense	probably benign	0.01
R1479:Vps13a	UTSW	19	16750114	splice site	probably benign
R1533:Vps13a	UTSW	19	16701130	nonsense	probably null
R1600:Vps13a	UTSW	19	16666272	missense	probably benign	0.01
R1870:Vps13a	UTSW	19	16759952	missense	probably damaging	1.00
R1871:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R1959:Vps13a	UTSW	19	16677938	missense	possibly damaging	0.49
R1960:Vps13a	UTSW	19	16725631	missense	probably damaging	1.00
R1993:Vps13a	UTSW	19	16722458	missense	probably benign	0.07
R2257:Vps13a	UTSW	19	16682174	missense	possibly damaging	0.85
R2276:Vps13a	UTSW	19	16710426	missense	possibly damaging	0.47
R2326:Vps13a	UTSW	19	16743057	missense	possibly damaging	0.71
R2338:Vps13a	UTSW	19	16720453	missense	probably damaging	1.00
R2359:Vps13a	UTSW	19	16652679	splice site	probably benign
R2421:Vps13a	UTSW	19	16759671	missense	probably benign
R2847:Vps13a	UTSW	19	16703599	missense	probably damaging	0.98
R3081:Vps13a	UTSW	19	16664737	missense	probably benign	0.02
R3522:Vps13a	UTSW	19	16766493	splice site	probably benign
R3613:Vps13a	UTSW	19	16685402	missense	probably damaging	1.00
R3797:Vps13a	UTSW	19	16745947	splice site	probably null
R3874:Vps13a	UTSW	19	16744953	missense	probably benign	0.01
R4032:Vps13a	UTSW	19	16616899	missense	probably damaging	1.00
R4111:Vps13a	UTSW	19	16640628	missense	probably damaging	1.00
R4383:Vps13a	UTSW	19	16701165	missense	probably damaging	1.00
R4504:Vps13a	UTSW	19	16695502	missense	possibly damaging	0.93
R4578:Vps13a	UTSW	19	16682110	missense	probably damaging	0.98
R4587:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4588:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4605:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4714:Vps13a	UTSW	19	16749856	missense	probably benign	0.01
R4756:Vps13a	UTSW	19	16655216	missense	probably benign	0.01
R4831:Vps13a	UTSW	19	16677992	missense	probably benign	0.04
R5068:Vps13a	UTSW	19	16746058	missense	probably benign	0.01
R5070:Vps13a	UTSW	19	16654484	missense	probably benign
R5082:Vps13a	UTSW	19	16744893	missense	probably damaging	1.00
R5182:Vps13a	UTSW	19	16695499	missense	possibly damaging	0.81
R5189:Vps13a	UTSW	19	16685315	missense	probably damaging	1.00
R5283:Vps13a	UTSW	19	16677970	missense	probably damaging	0.96
R5294:Vps13a	UTSW	19	16641667	missense	probably damaging	1.00
R5304:Vps13a	UTSW	19	16710387	missense	possibly damaging	0.78
R5554:Vps13a	UTSW	19	16722411	missense	probably damaging	1.00
R5592:Vps13a	UTSW	19	16725571	missense	probably damaging	1.00
R5611:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R5665:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R5671:Vps13a	UTSW	19	16715100	missense	probably benign	0.03
R5684:Vps13a	UTSW	19	16699045	missense	probably benign	0.00
R5767:Vps13a	UTSW	19	16664564	missense	probably damaging	1.00
R5810:Vps13a	UTSW	19	16666324	missense	probably benign	0.00
R5866:Vps13a	UTSW	19	16680023	missense	probably benign	0.04
R5886:Vps13a	UTSW	19	16664562	missense	probably benign	0.01
R5933:Vps13a	UTSW	19	16660530	missense	probably benign	0.34
R5965:Vps13a	UTSW	19	16619028	splice site	probably null
R6259:Vps13a	UTSW	19	16687170	nonsense	probably null
R6346:Vps13a	UTSW	19	16682214	missense	possibly damaging	0.94
R6459:Vps13a	UTSW	19	16664018	missense	possibly damaging	0.56
R6485:Vps13a	UTSW	19	16680050	missense	probably damaging	0.99
R6520:Vps13a	UTSW	19	16725579	missense	probably damaging	1.00
R6644:Vps13a	UTSW	19	16744919	missense	possibly damaging	0.90
R6932:Vps13a	UTSW	19	16678075	missense	probably benign	0.01
R6934:Vps13a	UTSW	19	16676194	missense	probably damaging	1.00
R6951:Vps13a	UTSW	19	16723740	missense	probably benign	0.00
R7027:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R7126:Vps13a	UTSW	19	16710879	missense	probably benign
R7206:Vps13a	UTSW	19	16754298	missense	probably damaging	1.00
R7248:Vps13a	UTSW	19	16678042	missense	probably benign	0.25
R7252:Vps13a	UTSW	19	16661064	missense	probably benign	0.00
R7255:Vps13a	UTSW	19	16654339	critical splice donor site	probably null
R7382:Vps13a	UTSW	19	16619485	missense	probably damaging	1.00
R7422:Vps13a	UTSW	19	16750173	missense	probably damaging	1.00
R7425:Vps13a	UTSW	19	16723702	missense	probably benign	0.13
R7523:Vps13a	UTSW	19	16703789	missense	probably benign
R7586:Vps13a	UTSW	19	16647598	missense	probably benign	0.08
R7587:Vps13a	UTSW	19	16703789	missense	probably benign	0.00
R7593:Vps13a	UTSW	19	16725663	missense	probably damaging	1.00
R7637:Vps13a	UTSW	19	16750149	missense	probably benign	0.02
R7813:Vps13a	UTSW	19	16651456	missense	possibly damaging	0.81
R7815:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R7861:Vps13a	UTSW	19	16655304	missense	probably damaging	1.00
R7909:Vps13a	UTSW	19	16720430	nonsense	probably null
R7939:Vps13a	UTSW	19	16740791	missense	possibly damaging	0.94
R8108:Vps13a	UTSW	19	16640787	missense	probably damaging	1.00
R8123:Vps13a	UTSW	19	16647702	missense	probably benign	0.01
R8134:Vps13a	UTSW	19	16654354	missense	possibly damaging	0.71
R8168:Vps13a	UTSW	19	16749548	missense	probably benign	0.09
R8272:Vps13a	UTSW	19	16749845	critical splice donor site	probably null
R8293:Vps13a	UTSW	19	16668605	missense	possibly damaging	0.81
R8303:Vps13a	UTSW	19	16616906	missense	probably benign	0.00
R8383:Vps13a	UTSW	19	16723705	missense	possibly damaging	0.83
R8386:Vps13a	UTSW	19	16701119	critical splice donor site	probably null
R8433:Vps13a	UTSW	19	16741236	missense	possibly damaging	0.56
R8436:Vps13a	UTSW	19	16740793	missense	probably benign	0.10
R8450:Vps13a	UTSW	19	16654507	splice site	probably null
R8476:Vps13a	UTSW	19	16722457	missense	possibly damaging	0.60
R8501:Vps13a	UTSW	19	16682120	missense	probably benign	0.39
R8552:Vps13a	UTSW	19	16754320	missense	probably damaging	0.99
R8680:Vps13a	UTSW	19	16645906	missense	possibly damaging	0.84
R8784:Vps13a	UTSW	19	16664789	missense	probably damaging	1.00
R8871:Vps13a	UTSW	19	16663822	missense	probably damaging	1.00
R8945:Vps13a	UTSW	19	16664750	missense	probably damaging	1.00
R8948:Vps13a	UTSW	19	16745976	missense	probably damaging	0.99
R8950:Vps13a	UTSW	19	16745976	missense	probably damaging	0.99
R8960:Vps13a	UTSW	19	16705883	missense	possibly damaging	0.67
R9189:Vps13a	UTSW	19	16686597	missense	probably benign
R9366:Vps13a	UTSW	19	16695530	missense	probably damaging	1.00
R9505:Vps13a	UTSW	19	16742544	missense	possibly damaging	0.94
R9601:Vps13a	UTSW	19	16645973	missense	possibly damaging	0.84
R9735:Vps13a	UTSW	19	16723747	missense	probably damaging	1.00
R9776:Vps13a	UTSW	19	16759594	missense	probably benign
R9796:Vps13a	UTSW	19	16654464	missense	probably benign	0.01
X0061:Vps13a	UTSW	19	16645868	missense	probably benign	0.40
X0066:Vps13a	UTSW	19	16742553	missense	probably benign	0.33
Z1177:Vps13a	UTSW	19	16699113	critical splice acceptor site	probably null
Z31818:Vps13a	UTSW	19	16780754	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCTTACATCTTTCCGGGGTC -3'
(R):5'- CCAAAGTAGTGTGGGTACTGG -3'

Sequencing Primer
(F):5'- CGGGGTCCTGTTCAGCTACTG -3'
(R):5'- ACTGGGGCTGTGGAGAG -3'

Posted On

2019-11-26