Incidental Mutation 'R7763:Sec31b'
ID 598098
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene Name Sec31 homolog B (S. cerevisiae)
Synonyms LOC240667, Sec31l2
MMRRC Submission 045819-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R7763 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 44516957-44545864 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 44523835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
AlphaFold Q3TZ89
Predicted Effect probably null
Transcript: ENSMUST00000063632
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111985
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165758
SMART Domains Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,514,602 W899R probably damaging Het
Abca5 A T 11: 110,272,497 W1631R possibly damaging Het
Actg2 T A 6: 83,527,368 D25V probably damaging Het
Akap10 G C 11: 61,915,505 D132E probably damaging Het
Angptl2 G T 2: 33,242,382 E334* probably null Het
Aprt T C 8: 122,574,935 R165G probably benign Het
B020004J07Rik T C 4: 101,837,141 I182V possibly damaging Het
Bmp1 A G 14: 70,492,084 F549S probably damaging Het
Capzb C T 4: 139,280,553 T215I probably benign Het
Car14 C T 3: 95,904,372 M1I probably null Het
Ccdc148 T A 2: 58,823,636 Q501L probably benign Het
Ccdc32 G A 2: 119,027,347 T12I probably damaging Het
Ccnf G A 17: 24,225,012 S594L probably damaging Het
Cdadc1 C T 14: 59,573,834 C409Y probably damaging Het
Cdh23 G T 10: 60,312,577 S2670R probably damaging Het
Cdh8 T A 8: 99,279,674 K94* probably null Het
Cdhr2 A T 13: 54,717,692 Y193F probably damaging Het
Cdon T A 9: 35,454,415 Y153* probably null Het
Chd1 G A 17: 15,733,041 G413R probably damaging Het
Cit A T 5: 115,987,001 T1582S probably benign Het
Clec4a3 T C 6: 122,964,340 L98P probably benign Het
Cpa4 T A 6: 30,583,645 D253E probably damaging Het
Cyhr1 A T 15: 76,658,547 Y138N probably damaging Het
Cyp2c40 T A 19: 39,807,168 N189I possibly damaging Het
Daam2 G T 17: 49,490,022 A245E probably benign Het
Dennd5b A G 6: 149,068,658 F121S probably damaging Het
Dgkd A G 1: 87,926,949 T658A probably benign Het
Dmwd T A 7: 19,080,340 L305Q probably damaging Het
Dnah5 A T 15: 28,313,855 Y1939F probably damaging Het
Dock5 T C 14: 67,821,327 T512A probably damaging Het
Dopey2 T A 16: 93,755,514 D398E probably benign Het
Eef1akmt4 A G 16: 20,618,529 H207R probably damaging Het
Egfr T C 11: 16,891,266 V719A probably damaging Het
Ep300 A T 15: 81,586,583 probably benign Het
Epha4 A G 1: 77,390,031 probably null Het
Erc2 T G 14: 27,876,204 probably null Het
Ergic1 A T 17: 26,638,827 Y209F possibly damaging Het
Fbxw28 A G 9: 109,326,633 I357T probably damaging Het
Flnb A T 14: 7,926,478 T1841S probably benign Het
Foxc1 G A 13: 31,808,028 S274N probably benign Het
Fto C T 8: 91,409,443 T115M probably damaging Het
Gm10228 C G 16: 89,041,299 C39S unknown Het
Gm7334 T C 17: 50,698,715 F10L possibly damaging Het
Hfm1 A G 5: 106,881,861 Y785H probably damaging Het
Hivep1 T A 13: 42,159,461 S1726T probably benign Het
Htt G T 5: 34,852,190 C1505F probably damaging Het
Hydin T C 8: 110,505,843 S1665P possibly damaging Het
Ifi209 T A 1: 173,642,879 N344K probably damaging Het
Ifnar2 T C 16: 91,399,293 M262T probably benign Het
Ighv7-3 T A 12: 114,153,207 S112C probably damaging Het
Igkv4-86 A G 6: 68,910,579 S59P probably benign Het
Iglv1 A G 16: 19,085,489 probably benign Het
Ipo7 T A 7: 110,052,799 D928E possibly damaging Het
Itgae G T 11: 73,123,269 probably null Het
Kbtbd12 T A 6: 88,618,197 Q217L probably benign Het
Kcnma1 T A 14: 23,300,006 Y1155F possibly damaging Het
Kif14 A G 1: 136,516,383 E1371G probably benign Het
Lilrb4a A T 10: 51,491,046 Y10F probably benign Het
Lrp2 A T 2: 69,503,388 V1503E probably damaging Het
Mfsd6 A T 1: 52,708,640 D355E probably benign Het
Mri1 T C 8: 84,251,028 H226R Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Muc4 T A 16: 32,753,311 L1063H probably benign Het
Mzf1 A T 7: 13,044,091 I541N probably damaging Het
Nasp T A 4: 116,612,033 E116D probably benign Het
Nlrp10 T A 7: 108,925,826 E149V probably damaging Het
Notch4 G A 17: 34,582,418 C1080Y probably damaging Het
Nova1 T G 12: 46,720,698 I147L unknown Het
Ogdh A G 11: 6,338,558 M223V probably benign Het
Olfr1391 G T 11: 49,327,671 A87S probably benign Het
Olfr444 T C 6: 42,955,789 I97T probably benign Het
Olfr732 A T 14: 50,281,488 I255N probably damaging Het
Olfr792 G T 10: 129,541,455 R306L probably benign Het
P3h3 T C 6: 124,854,432 Q330R probably benign Het
Pcdhb10 A G 18: 37,411,882 T4A not run Het
Pkd2l2 A T 18: 34,433,287 probably null Het
Plekhb1 C T 7: 100,645,663 V168I probably benign Het
Plxna4 C T 6: 32,223,980 R753H probably damaging Het
Prex1 G C 2: 166,713,709 P4A unknown Het
Ptgdr A G 14: 44,859,078 V59A probably damaging Het
Ralgapa1 T A 12: 55,757,955 I519F probably benign Het
Rbpms A G 8: 33,789,453 I170T probably benign Het
Skint11 A T 4: 114,227,708 Y138F probably benign Het
Slain2 A G 5: 72,948,610 Y196C probably damaging Het
Slco1b2 T A 6: 141,676,224 C503* probably null Het
Slfn3 A T 11: 83,214,788 Y537F possibly damaging Het
Slu7 T C 11: 43,444,765 Y443H probably damaging Het
Sorl1 T A 9: 42,043,909 E683D probably damaging Het
Sos1 T A 17: 80,413,713 I893L probably benign Het
St8sia2 T A 7: 73,943,321 Y329F probably damaging Het
Stra6l C A 4: 45,869,570 S212* probably null Het
Syne3 C T 12: 104,997,495 probably benign Het
Tenm4 T A 7: 96,895,692 I2342N probably benign Het
Tescl T A 7: 24,333,263 E212D probably benign Het
Trip11 A G 12: 101,844,855 S1879P probably benign Het
Ube2c A T 2: 164,771,291 probably null Het
Umodl1 T A 17: 30,986,456 I675N probably benign Het
Vipr2 T C 12: 116,122,718 F121S probably damaging Het
Vmn1r206 A T 13: 22,620,669 S123T possibly damaging Het
Vmn1r58 A G 7: 5,410,913 V106A probably damaging Het
Vmn2r112 A G 17: 22,603,118 Y259C probably damaging Het
Vmn2r66 T C 7: 85,005,701 K467E probably benign Het
Vmn2r98 T C 17: 19,080,535 F600L probably benign Het
Vps13a T A 19: 16,746,000 N278I possibly damaging Het
Vwa5a A C 9: 38,741,162 D747A possibly damaging Het
Xdh G A 17: 73,934,834 P157S possibly damaging Het
Xrn1 G A 9: 95,998,348 probably null Het
Zfp362 T A 4: 128,787,031 H180L probably benign Het
Zfp560 A T 9: 20,347,323 W748R possibly damaging Het
Zfp808 A T 13: 62,172,664 Q569L probably benign Het
Zfp93 T A 7: 24,275,218 D209E possibly damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 splice site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7952:Sec31b UTSW 19 44520540 missense probably benign 0.01
R8057:Sec31b UTSW 19 44519365 missense probably damaging 1.00
R8197:Sec31b UTSW 19 44524516 missense probably benign 0.25
R8739:Sec31b UTSW 19 44519181 missense probably benign 0.16
R8822:Sec31b UTSW 19 44519263 missense probably benign 0.02
R8837:Sec31b UTSW 19 44517667 nonsense probably null
R8916:Sec31b UTSW 19 44532344 missense
R9069:Sec31b UTSW 19 44519302 missense probably damaging 0.98
R9259:Sec31b UTSW 19 44517416 missense probably damaging 1.00
R9493:Sec31b UTSW 19 44520582 missense probably damaging 1.00
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACAGTCGCTGGGTAGGAAGC -3'
(R):5'- GGTTGATGACGTACACACAGG -3'

Sequencing Primer
(F):5'- TCGCTGGGTAGGAAGCTCATAG -3'
(R):5'- TGCATAGAAATCCAAGGCCTG -3'
Posted On 2019-11-26